Stem-loop sequence hsa-mir-335

AccessionMI0000816
Symbol HGNC:MIR335
DescriptionHomo sapiens miR-335 stem-loop
Gene family MIPF0000196; mir-335
Stem-loop
   -------u  -uu    c        a         c        u  gu 
5'         gu   ugag ggggguca gagcaauaa gaaaaaug uu  c
           ||   |||| |||||||| ||||||||| |||||||| ||   
3'         cg   acuc ccuccagu cucguuauu cuuuuugc aa  a
   acuuauau  uuu    u        c         a        c  au 
Get sequence
Deep sequencing
20477 reads, 1.11e+04 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr7: 130496111-130496204 [+]
intergenic
Database links

Mature sequence hsa-miR-335-5p

Accession MIMAT0000765
Previous IDshsa-miR-335
Sequence

16 - 

ucaagagcaauaacgaaaaaugu

 - 38

Get sequence
Deep sequencing1219 reads, 48 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-335-3p

Accession MIMAT0004703
Previous IDshsa-miR-335*
Sequence

52 - 

uuuuucauuauugcuccugacc

 - 73

Get sequence
Deep sequencing322 reads, 41 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).