Stem-loop sequence hsa-mir-339

Accession MI0000815
Symbol HGNC:MIR339
Description Homo sapiens miR-339 stem-loop
Gene family MIPF0000193; mir-339
Stem-loop
----------c       c    cu c     c  c   a       u  g 
           ggggcgg cgcu  c cuguc uc agg gcucacg gu c
           ||||||| ||||  | ||||| || ||| ||||||| ||  
           ccccguc gcgg  g gacag ag ucc cgagugu cg c
cgcgucuguga       c    cc a     c  c   g       c  u 
Get sequence
Deep sequencing
2379 reads, 44 experiments
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,3]. Expression of mature miRNA was later verified in human [2,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 1062569-1062662 [-]
sense
OTTHUMT00000322818 ; C7orf50-003; intron 1
OTTHUMT00000322852 ; C7orf50-005; intron 1
OTTHUMT00000322818 ; C7orf50-003; intron 1
OTTHUMT00000322852 ; C7orf50-005; intron 1
OTTHUMT00000322818 ; C7orf50-003; intron 1
OTTHUMT00000322852 ; C7orf50-005; intron 1
OTTHUMT00000322817 ; C7orf50-002; intron 2
OTTHUMT00000322816 ; C7orf50-001; intron 2
OTTHUMT00000322853 ; C7orf50-006; intron 2
OTTHUMT00000352031 ; C7orf50-007; intron 2
OTTHUMT00000322817 ; C7orf50-002; intron 2
OTTHUMT00000322816 ; C7orf50-001; intron 2
OTTHUMT00000322853 ; C7orf50-006; intron 2
OTTHUMT00000352031 ; C7orf50-007; intron 2
OTTHUMT00000322817 ; C7orf50-002; intron 2
OTTHUMT00000322816 ; C7orf50-001; intron 2
OTTHUMT00000322853 ; C7orf50-006; intron 2
OTTHUMT00000352031 ; C7orf50-007; intron 2
ENST00000412051 ; C7orf50-003; intron 1
ENST00000444428 ; C7orf50-005; intron 1
ENST00000444428 ; C7orf50-005; intron 1
ENST00000412051 ; C7orf50-003; intron 1
ENST00000412051 ; C7orf50-003; intron 1
ENST00000444428 ; C7orf50-005; intron 1
ENST00000397098 ; C7orf50-002; intron 2
ENST00000357429 ; C7orf50-001; intron 2
ENST00000488073 ; C7orf50-006; intron 2
ENST00000491163 ; C7orf50-007; intron 2
ENST00000397100 ; C7orf50-201; intron 2
ENST00000397100 ; C7orf50-201; intron 2
ENST00000488073 ; C7orf50-006; intron 2
ENST00000491163 ; C7orf50-007; intron 2
ENST00000397098 ; C7orf50-002; intron 2
ENST00000357429 ; C7orf50-001; intron 2
ENST00000397098 ; C7orf50-002; intron 2
ENST00000357429 ; C7orf50-001; intron 2
ENST00000488073 ; C7orf50-006; intron 2
ENST00000491163 ; C7orf50-007; intron 2
ENST00000397100 ; C7orf50-201; intron 2
Database links

Mature sequence hsa-miR-339-5p

Accession MIMAT0000764
Previous IDs hsa-miR-339
Sequence

15 - 

ucccuguccuccaggagcucacg

 - 37

Get sequence
Deep sequencing 956 reads, 28 experiments
Evidence experimental; cloned [2,4]
Validated targets
Predicted targets

Mature sequence hsa-miR-339-3p

Accession MIMAT0004702
Sequence

50 - 

ugagcgccucgacgacagagccg

 - 72

Get sequence
Deep sequencing 1414 reads, 36 experiments
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).