Stem-loop sequence hsa-mir-338

AccessionMI0000814
Symbol HGNC:MIR338
DescriptionHomo sapiens miR-338 stem-loop
Gene family MIPF0000097; mir-338
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-338. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-338 is located in an intronic region within the gene for apoptosis-associated tyrosine kinase (AATK). It has been predicted that it may downregulate genes which have a downstream negative effect on AATK expression.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      c      u   -         -   gauga 
5' ucu caacaa auc cuggugcug agu     c
   ||| |||||| ||| ||||||||| |||     u
3' aga guuguu uag gacuacgac uca     c
      a      u   u         c   gcgga 
Get sequence
Deep sequencing
5050 reads, 677 reads per million, 58 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 81125883-81125949 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-338
hsa-mir-1250chr17: 81133196-81133308 [-]
hsa-mir-338chr17: 81125883-81125949 [-]
hsa-mir-3065chr17: 81125877-81125955 [+]
hsa-mir-657chr17: 81125276-81125373 [-]
Database links

Mature sequence hsa-miR-338-5p

Accession MIMAT0004701
Sequence

6 - 

aacaauauccuggugcugagug

 - 27

Get sequence
Deep sequencing145 reads, 37 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-338-3p

Accession MIMAT0000763
Previous IDshsa-miR-338
Sequence

42 - 

uccagcaucagugauuuuguug

 - 63

Get sequence
Deep sequencing506 reads, 42 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).