Stem-loop sequence hsa-mir-338

AccessionMI0000814 (change log)
Symbol HGNC:MIR338
DescriptionHomo sapiens miR-338 stem-loop
Gene family MIPF0000097; mir-338
Literature search

96 open access papers mention hsa-mir-338
(706 sentences)

Stem-loop
      c      u   -         -   gauga 
5' ucu caacaa auc cuggugcug agu     c
   ||| |||||| ||| ||||||||| |||     u
3' aga guuguu uag gacuacgac uca     c
      a      u   u         c   gcgga 
Get sequence
Deep sequencing
85545 reads, 97.2 reads per million, 144 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 81125883-81125949 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-338
hsa-mir-1250chr17: 81133196-81133308 [-]
hsa-mir-338chr17: 81125883-81125949 [-]
hsa-mir-3065chr17: 81125877-81125955 [+]
hsa-mir-657chr17: 81125276-81125373 [-]
Database links

Mature sequence hsa-miR-338-5p

Accession MIMAT0004701
Sequence

6 - 

aacaauauccuggugcugagug

 - 27

Get sequence
Deep sequencing51883 reads, 130 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

Mature sequence hsa-miR-338-3p

Accession MIMAT0000763
Previous IDshsa-miR-338
Sequence

42 - 

uccagcaucagugauuuuguug

 - 63

Get sequence
Deep sequencing33660 reads, 140 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).