Stem-loop sequence hsa-mir-331

Accession

MI0000812

Symbol

HGNC:MIR331

Description

Homo sapiens miR-331 stem-loop

Gene family

MIPF0000199; mir-331

Stem-loop

gaguuugguuuu         u        u    u       au ccaga 
            guuuggguu guucuagg augg cccaggg  c     u
            ||||||||| |||||||| |||| |||||||  |     c
            cgaauccaa caagaucc uauc ggguccc  g     a
----------cu         c        -    c       cg accaa 

Deep sequencing

5439 reads, 30 experiments

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context

• Coordinates (GRCh37.p5): chr12: 95702196-95702289 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-331

• hsa-mir-331: chr12: 95702196-95702289 [+]
• hsa-mir-3685: chr12: 95703699-95703760 [+]

Database links

• ENTREZGENE: 442903;MIR331
• HGNC: 31772;MIR331

Mature sequence hsa-miR-331-5p

• Accession: MIMAT0004700
• Sequence: 26 - cuagguauggucccagggaucc - 47
• Deep sequencing: 45 reads, 16 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-331-5p
  • MICRORNA.ORG:hsa-miR-331-5p
  • MIRDB:hsa-miR-331-5p
  • RNA22-HSA:hsa-miR-331-5p
  • TARGETMINER:hsa-miR-331-5p
  • TARGETSCAN-VERT:hsa-miR-331-5p
  • PICTAR-VERT:hsa-miR-331

Mature sequence hsa-miR-331-3p

• Accession: MIMAT0000760
• Previous IDs: hsa-miR-331
• Sequence: 61 - gccccugggccuauccuagaa - 81
• Deep sequencing: 5379 reads, 23 experiments
• Evidence: experimental; cloned [3-4]
• Validated targets:
  • MIRECORDS:hsa-miR-331-3p
  • MIRTARBASE:hsa-miR-331-3p
  • TARBASE:hsa-miR-331-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-331-3p
  • MICRORNA.ORG:hsa-miR-331-3p
  • MIRDB:hsa-miR-331-3p
  • RNA22-HSA:hsa-miR-331-3p
  • TARGETMINER:hsa-miR-331-3p
  • TARGETSCAN-VERT:hsa-miR-331-3p
  • PICTAR-VERT:hsa-miR-331

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).