Stem-loop sequence hsa-mir-331

AccessionMI0000812
Symbol HGNC:MIR331
DescriptionHomo sapiens miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
   gaguuugguuuu         u        u    u       au ccaga 
5'             guuuggguu guucuagg augg cccaggg  c     u
               ||||||||| |||||||| |||| |||||||  |     c
3'             cgaauccaa caagaucc uauc ggguccc  g     a
   ----------cu         c        -    c       cg accaa 
Get sequence
Deep sequencing
17734 reads, 1.43e+03 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr12: 95308420-95308513 [+]
antisense
OTTHUMT00000407530 ; NDUFA12-008; intron 1
OTTHUMT00000407531 ; NDUFA12-004; intron 4
ENST00000547447 ; NDUFA12-008; intron 1
ENST00000552205 ; NDUFA12-004; intron 4
Clustered miRNAs
< 10kb from hsa-mir-331
hsa-mir-331chr12: 95308420-95308513 [+]
hsa-mir-3685chr12: 95309923-95309984 [+]
Database links

Mature sequence hsa-miR-331-5p

Accession MIMAT0004700
Sequence

26 - 

cuagguauggucccagggaucc

 - 47

Get sequence
Deep sequencing391 reads, 41 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-331-3p

Accession MIMAT0000760
Previous IDshsa-miR-331
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Deep sequencing11549 reads, 51 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).