miRNA Entry for MI0000811

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

mir-148/mir-152 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-148
Identifiers
Symbol	mir-148
Rfam	RF00248
miRBase	MI0000253
miRBase family	MIPF0000056
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015).^[1]^[2]^[3] miR-148 has also been predicted in chicken (MI0001189).

These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462).^[1]

The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

[edit] Targets of miR-148

MicroRNAs act by lowering the expression of genes by binding to target sites in the 3' UTR of the mRNAs. However recently it was shown by Duursma and colleagues that miR-148 down regulates Dnmt3b by binding to a region in the protein coding region.^[4]

[edit] References

^ ^a ^b Lagos-Quintana, M; Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T (2002). "Identification of tissue-specific microRNAs from mouse". Curr Biol 12 (9): 735–739. doi:10.1016/S0960-9822(02)00809-6. PMID 12007417.
^ Kim, J; Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G (2004). "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons". Proc Natl Acad Sci USA 101 (1): 360–365. Bibcode 2003PNAS..101..360K. doi:10.1073/pnas.2333854100. PMC 314190. PMID 14691248. //www.ncbi.nlm.nih.gov/pmc/articles/PMC314190/.
^ Chen, PY; Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T (2005). "The developmental miRNA profiles of zebrafish as determined by small RNA cloning". Genes Dev. 19 (11): 1288–1293. doi:10.1101/gad.1310605. PMC 1142552. PMID 15937218. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1142552/.
^ Duursma AM, Kedde M, Schrier M, le Sage C, Agami R (May 2008). "miR-148 targets human DNMT3b protein coding region". RNA 14 (5): 872–7. doi:10.1261/rna.972008. PMC 2327368. PMID 18367714. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2327368/.

[edit] External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

caagcac uu a ug u a ca gugg u ga agc uuugagg aaguucugu au cacu ggcu c c || ||| ||||||| ||||||||| || |||| |||| | u cu ucg aagcucu uucaagaca ua guga cuga g c -----au -u a gu c c -- --aa u

Coordinates (GRCh37.p5)

Overlapping transcripts

chr12: 54731000-54731098 [+]

sense: OTTHUMT00000406596 ; RP11-968A15.8-001; intron 1

OTTHUMT00000405751 ; COPZ1-007; intron 1

OTTHUMT00000405752 ; COPZ1-008; intron 1

OTTHUMT00000405753 ; COPZ1-001; intron 1

OTTHUMT00000405754 ; COPZ1-002; intron 1

OTTHUMT00000405755 ; COPZ1-009; intron 1

OTTHUMT00000405756 ; COPZ1-010; intron 1

OTTHUMT00000405757 ; COPZ1-011; intron 1

OTTHUMT00000405758 ; COPZ1-016; intron 1

OTTHUMT00000406154 ; COPZ1-018; intron 1

OTTHUMT00000405759 ; COPZ1-017; intron 1

OTTHUMT00000405760 ; COPZ1-004; intron 1

OTTHUMT00000405761 ; COPZ1-003; intron 1

OTTHUMT00000405762 ; COPZ1-012; intron 1

OTTHUMT00000405763 ; COPZ1-005; intron 1

OTTHUMT00000405764 ; COPZ1-013; intron 1

OTTHUMT00000405765 ; COPZ1-014; intron 1

OTTHUMT00000406596 ; RP11-968A15.8-001; intron 1

OTTHUMT00000405751 ; COPZ1-007; intron 1

OTTHUMT00000405752 ; COPZ1-008; intron 1

OTTHUMT00000405753 ; COPZ1-001; intron 1

OTTHUMT00000405754 ; COPZ1-002; intron 1

OTTHUMT00000405755 ; COPZ1-009; intron 1

OTTHUMT00000405756 ; COPZ1-010; intron 1

OTTHUMT00000405757 ; COPZ1-011; intron 1

OTTHUMT00000405758 ; COPZ1-016; intron 1

OTTHUMT00000406154 ; COPZ1-018; intron 1

OTTHUMT00000405759 ; COPZ1-017; intron 1

OTTHUMT00000405760 ; COPZ1-004; intron 1

OTTHUMT00000405761 ; COPZ1-003; intron 1

OTTHUMT00000405762 ; COPZ1-012; intron 1

OTTHUMT00000405763 ; COPZ1-005; intron 1

OTTHUMT00000405764 ; COPZ1-013; intron 1

OTTHUMT00000405765 ; COPZ1-014; intron 1

OTTHUMT00000406596 ; RP11-968A15.8-001; intron 1

OTTHUMT00000405751 ; COPZ1-007; intron 1

OTTHUMT00000405752 ; COPZ1-008; intron 1

OTTHUMT00000405753 ; COPZ1-001; intron 1

OTTHUMT00000405754 ; COPZ1-002; intron 1

OTTHUMT00000405755 ; COPZ1-009; intron 1

OTTHUMT00000405756 ; COPZ1-010; intron 1

OTTHUMT00000405757 ; COPZ1-011; intron 1

OTTHUMT00000405758 ; COPZ1-016; intron 1

OTTHUMT00000406154 ; COPZ1-018; intron 1

OTTHUMT00000405759 ; COPZ1-017; intron 1

OTTHUMT00000405760 ; COPZ1-004; intron 1

OTTHUMT00000405761 ; COPZ1-003; intron 1

OTTHUMT00000405762 ; COPZ1-012; intron 1

OTTHUMT00000405763 ; COPZ1-005; intron 1

OTTHUMT00000405764 ; COPZ1-013; intron 1

OTTHUMT00000405765 ; COPZ1-014; intron 1

OTTHUMT00000405750 ; COPZ1-006; intron 2

OTTHUMT00000405750 ; COPZ1-006; intron 2

OTTHUMT00000405750 ; COPZ1-006; intron 2

ENST00000553061 ; RP11-968A15.8-001; intron 1

ENST00000548076 ; COPZ1-007; intron 1

ENST00000553009 ; COPZ1-008; intron 1

ENST00000262061 ; COPZ1-001; intron 1

ENST00000549043 ; COPZ1-002; intron 1

ENST00000551962 ; COPZ1-009; intron 1

ENST00000552218 ; COPZ1-010; intron 1

ENST00000551412 ; COPZ1-011; intron 1

ENST00000550027 ; COPZ1-016; intron 1

ENST00000553231 ; COPZ1-018; intron 1

ENST00000552362 ; COPZ1-017; intron 1

ENST00000455864 ; COPZ1-004; intron 1

ENST00000550171 ; COPZ1-003; intron 1

ENST00000549116 ; COPZ1-012; intron 1

ENST00000551779 ; COPZ1-005; intron 1

ENST00000548281 ; COPZ1-013; intron 1

ENST00000548753 ; COPZ1-014; intron 1

ENST00000416254 ; COPZ1-201; intron 1

ENST00000553061 ; RP11-968A15.8-001; intron 1

ENST00000548076 ; COPZ1-007; intron 1

ENST00000553009 ; COPZ1-008; intron 1

ENST00000262061 ; COPZ1-001; intron 1

ENST00000549043 ; COPZ1-002; intron 1

ENST00000551962 ; COPZ1-009; intron 1

ENST00000552218 ; COPZ1-010; intron 1

ENST00000551412 ; COPZ1-011; intron 1

ENST00000550027 ; COPZ1-016; intron 1

ENST00000553231 ; COPZ1-018; intron 1

ENST00000552362 ; COPZ1-017; intron 1

ENST00000455864 ; COPZ1-004; intron 1

ENST00000550171 ; COPZ1-003; intron 1

ENST00000549116 ; COPZ1-012; intron 1

ENST00000551779 ; COPZ1-005; intron 1

ENST00000548281 ; COPZ1-013; intron 1

ENST00000548753 ; COPZ1-014; intron 1

ENST00000416254 ; COPZ1-201; intron 1

ENST00000553061 ; RP11-968A15.8-001; intron 1

ENST00000548076 ; COPZ1-007; intron 1

ENST00000553009 ; COPZ1-008; intron 1

ENST00000262061 ; COPZ1-001; intron 1

ENST00000549043 ; COPZ1-002; intron 1

ENST00000551962 ; COPZ1-009; intron 1

ENST00000552218 ; COPZ1-010; intron 1

ENST00000551412 ; COPZ1-011; intron 1

ENST00000550027 ; COPZ1-016; intron 1

ENST00000553231 ; COPZ1-018; intron 1

ENST00000552362 ; COPZ1-017; intron 1

ENST00000455864 ; COPZ1-004; intron 1

ENST00000550171 ; COPZ1-003; intron 1

ENST00000549116 ; COPZ1-012; intron 1

ENST00000551779 ; COPZ1-005; intron 1

ENST00000548281 ; COPZ1-013; intron 1

ENST00000548753 ; COPZ1-014; intron 1

ENST00000416254 ; COPZ1-201; intron 1

ENST00000552848 ; COPZ1-006; intron 2

ENST00000552848 ; COPZ1-006; intron 2

ENST00000552848 ; COPZ1-006; intron 2

Mature sequence hsa-miR-148b-5p
Accession	MIMAT0004699
Previous IDs	hsa-miR-148b*
Sequence	25 - aaguucuguuauacacucaggc - 46 Get sequence
Deep sequencing	332 reads, 16 experiments
Evidence	experimental; cloned [3]
Validated targets	TARBASE:hsa-miR-148b-5p
Predicted targets	DIANA-MICROT:hsa-miR-148b-5p MICRORNA.ORG:hsa-miR-148b-5p MIRDB:hsa-miR-148b-5p RNA22-HSA:hsa-miR-148b-5p TARGETMINER:hsa-miR-148b-5p PICTAR-VERT:hsa-miR-148b

Mature sequence hsa-miR-148b-3p
Accession	MIMAT0000759
Previous IDs	hsa-miR-148b
Sequence	63 - ucagugcaucacagaacuuugu - 84 Get sequence
Deep sequencing	46635 reads, 35 experiments
Evidence	experimental; cloned [3-4]
Validated targets	TARBASE:hsa-miR-148b-3p
Predicted targets	DIANA-MICROT:hsa-miR-148b-3p MICRORNA.ORG:hsa-miR-148b-3p MIRDB:hsa-miR-148b-3p RNA22-HSA:hsa-miR-148b-3p TARGETMINER:hsa-miR-148b-3p TARGETSCAN-VERT:hsa-miR-148b PICTAR-VERT:hsa-miR-148b

References
1	PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2	PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3	PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4	PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).

miRBase

Stem-loop sequence hsa-mir-148b

[edit] Targets of miR-148

[edit] References

[edit] External links

Mature sequence hsa-miR-148b-5p

Mature sequence hsa-miR-148b-3p

References