Stem-loop sequence hsa-mir-148b

AccessionMI0000811 (change log)
Symbol HGNC:MIR148B
DescriptionHomo sapiens miR-148b stem-loop
Gene family MIPF0000056; mir-148
Literature search

150 open access papers mention hsa-mir-148b
(759 sentences)

Stem-loop
   caagcac  uu   a       ug         u  a    ca    gugg u 
5'        ga  agc uuugagg  aaguucugu au cacu  ggcu    c c
          ||  ||| |||||||  ||||||||| || ||||  ||||    | u
3'        cu  ucg aagcucu  uucaagaca ua guga  cuga    g c
   -----au  -u   a       gu         c  c    --    --aa u 
Get sequence
Deep sequencing
1331831 reads, 2.75e+03 reads per million, 158 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression was later verified in human [3,4].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 54337216-54337314 [+]
sense
OTTHUMT00000358865 ; HOXC13-001; intron 1
ENST00000243056 ; HOXC13-001; intron 1
Database links

Mature sequence hsa-miR-148b-5p

Accession MIMAT0004699
Previous IDshsa-miR-148b*
Sequence

25 - 

aaguucuguuauacacucaggc

 - 46

Get sequence
Deep sequencing18367 reads, 130 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-148b-3p

Accession MIMAT0000759
Previous IDshsa-miR-148b
Sequence

63 - 

ucagugcaucacagaacuuugu

 - 84

Get sequence
Deep sequencing1313333 reads, 158 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).