Stem-loop sequence hsa-mir-135b

Accession

MI0000810

Symbol

HGNC:MIR135B

Description

Homo sapiens miR-135b stem-loop

Gene family

MIPF0000028; mir-135

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Stem-loop

-------ca    -                   cau          --   cu 
         cucu gcuguggccuauggcuuuu   uccuauguga  uug  g
         |||| |||||||||||||||||||   ||||||||||  |||   
         ggga ugacaucggguaccgaaaa   gggauguacu  aac  u
ccucgagcg    g                   -uc          ca   cc 

Deep sequencing

516 reads, 25 experiments

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context

• Coordinates (GRCh37.p5): chr1: 205417430-205417526 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000090402 ; LEMD1-002; intron 1

  OTTHUMT00000090405 ; LEMD1-005; intron 1

  OTTHUMT00000090402 ; LEMD1-002; intron 1

  OTTHUMT00000090405 ; LEMD1-005; intron 1

  OTTHUMT00000090402 ; LEMD1-002; intron 1

  OTTHUMT00000090405 ; LEMD1-005; intron 1

  ENST00000367154 ; LEMD1-002; intron 1

  ENST00000495594 ; LEMD1-005; intron 1

  ENST00000367154 ; LEMD1-002; intron 1

  ENST00000495594 ; LEMD1-005; intron 1

  ENST00000367154 ; LEMD1-002; intron 1

  ENST00000495594 ; LEMD1-005; intron 1

Database links

• ENTREZGENE: 442891;MIR135B
• HGNC: 31760;MIR135B

Mature sequence hsa-miR-135b-5p

• Accession: MIMAT0000758
• Previous IDs: hsa-miR-135b
• Sequence: 16 - uauggcuuuucauuccuauguga - 38
• Deep sequencing: 440 reads, 24 experiments
• Evidence: experimental; cloned [3-4]
• Validated targets:
  • TARBASE:hsa-miR-135b-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-135b-5p
  • MICRORNA.ORG:hsa-miR-135b-5p
  • MIRDB:hsa-miR-135b-5p
  • RNA22-HSA:hsa-miR-135b-5p
  • TARGETMINER:hsa-miR-135b-5p
  • TARGETSCAN-VERT:hsa-miR-135b
  • PICTAR-VERT:hsa-miR-135b

Mature sequence hsa-miR-135b-3p

• Accession: MIMAT0004698
• Previous IDs: hsa-miR-135b*
• Sequence: 55 - auguagggcuaaaagccauggg - 76
• Deep sequencing: 76 reads, 8 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-135b-3p
  • MICRORNA.ORG:hsa-miR-135b-3p
  • MIRDB:hsa-miR-135b-3p
  • RNA22-HSA:hsa-miR-135b-3p
  • TARGETMINER:hsa-miR-135b-3p
  • PICTAR-VERT:hsa-miR-135b

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).