Stem-loop sequence hsa-mir-135b

AccessionMI0000810 (change log)
Symbol HGNC:MIR135B
DescriptionHomo sapiens miR-135b stem-loop
Gene family MIPF0000028; mir-135
Literature search

190 open access papers mention hsa-mir-135b
(876 sentences)

Stem-loop
   -------ca    -                   cau          --   cu 
5'          cucu gcuguggccuauggcuuuu   uccuauguga  uug  g
            |||| |||||||||||||||||||   ||||||||||  |||   
3'          ggga ugacaucggguaccgaaaa   gggauguacu  aac  u
   ccucgagcg    g                   -uc          ca   cc 
Get sequence
Deep sequencing
157297 reads, 189 reads per million, 147 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 205448302-205448398 [-]
intergenic
Database links

Mature sequence hsa-miR-135b-5p

Accession MIMAT0000758
Previous IDshsa-miR-135b
Sequence

16 - 

uauggcuuuucauuccuauguga

 - 38

Get sequence
Deep sequencing156819 reads, 146 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

Mature sequence hsa-miR-135b-3p

Accession MIMAT0004698
Previous IDshsa-miR-135b*
Sequence

55 - 

auguagggcuaaaagccauggg

 - 76

Get sequence
Deep sequencing472 reads, 60 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).