Stem-loop sequence hsa-mir-135b

AccessionMI0000810
Symbol HGNC:MIR135B
DescriptionHomo sapiens miR-135b stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -------ca    -                   cau          --   cu 
5'          cucu gcuguggccuauggcuuuu   uccuauguga  uug  g
            |||| |||||||||||||||||||   ||||||||||  |||   
3'          ggga ugacaucggguaccgaaaa   gggauguacu  aac  u
   ccucgagcg    g                   -uc          ca   cc 
Get sequence
Deep sequencing
1530 reads, 699 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 205448302-205448398 [-]
intergenic
Database links

Mature sequence hsa-miR-135b-5p

Accession MIMAT0000758
Previous IDshsa-miR-135b
Sequence

16 - 

uauggcuuuucauuccuauguga

 - 38

Get sequence
Deep sequencing444 reads, 42 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-135b-3p

Accession MIMAT0004698
Previous IDshsa-miR-135b*
Sequence

55 - 

auguagggcuaaaagccauggg

 - 76

Get sequence
Deep sequencing51 reads, 12 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).