Stem-loop sequence hsa-mir-151a

Accession

MI0000809 (change log)

Previous IDs

hsa-mir-151

Symbol

HGNC:MIR151A

Description

Homo sapiens miR-151a stem-loop

Gene family

MIPF0000057; mir-28

Literature search

102 open access papers mention hsa-mir-151a
(492 sentences)

Stem-loop

   ---------------u      c            ca          u ucu 
5'                 uuccug ccucgaggagcu  cagucuagua g   c
                   |||||| ||||||||||||  |||||||||| |    
3'                 agggac ggaguuccucga  gucagaucau c   a
   cuccacucauacuggu      a            -a          c ccu 

Deep sequencing

1352751 reads, 4.89e+03 reads per million, 159 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 140732564-140732653 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR151
• HGNC:MIR151A
• RNAcentral:URS00002ECE14_9606
• miRBase Tracker:MI0000809

Mature sequence hsa-miR-151a-5p

• Accession: MIMAT0004697
• Previous IDs: hsa-miR-151-5p
• Sequence: 11 - ucgaggagcucacagucuagu - 31
• Deep sequencing: 668216 reads, 159 experiments
• Evidence: experimental; cloned [4-5]
• Database links:
  • RNAcentral:URS00005F8E5B_9606
• Predicted targets:
  • TargetMiner:hsa-miR-151a-5p
  • TargetScanVert:hsa-miR-151a-5p
  • miRDB:hsa-miR-151a-5p
  • microrna.org:hsa-miR-151a-5p

Mature sequence hsa-miR-151a-3p

• Accession: MIMAT0000757
• Previous IDs: hsa-miR-151;hsa-miR-151-3p
• Sequence: 47 - cuagacugaagcuccuugagg - 67
• Deep sequencing: 684519 reads, 159 experiments
• Evidence: experimental; cloned [3-5], Northern [3]
• Database links:
  • RNAcentral:URS000016C318_9606
• Predicted targets:
  • TargetMiner:hsa-miR-151a-3p
  • TargetScanVert:hsa-miR-151a-3p
  • miRDB:hsa-miR-151a-3p
  • microrna.org:hsa-miR-151a-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).