Stem-loop sequence hsa-mir-151a

Accession

MI0000809

Previous IDs

hsa-mir-151

Symbol

HGNC:MIR151

Description

Homo sapiens miR-151a stem-loop

Gene family

MIPF0000057; mir-28

Stem-loop

---------------u      c            ca          u ucu 
                uuccug ccucgaggagcu  cagucuagua g   c
                |||||| ||||||||||||  |||||||||| |    
                agggac ggaguuccucga  gucagaucau c   a
cuccacucauacuggu      a            -a          c ccu 

Deep sequencing

38081 reads, 48 experiments

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh37.p5): chr8: 141742663-141742752 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000378366 ; PTK2-049; intron 3

  OTTHUMT00000378370 ; PTK2-051; intron 3

  OTTHUMT00000378366 ; PTK2-049; intron 3

  OTTHUMT00000378370 ; PTK2-051; intron 3

  OTTHUMT00000378366 ; PTK2-049; intron 3

  OTTHUMT00000378370 ; PTK2-051; intron 3

  OTTHUMT00000378367 ; PTK2-048; intron 4

  OTTHUMT00000378367 ; PTK2-048; intron 4

  OTTHUMT00000378367 ; PTK2-048; intron 4

  OTTHUMT00000378369 ; PTK2-052; intron 6

  OTTHUMT00000378369 ; PTK2-052; intron 6

  OTTHUMT00000378369 ; PTK2-052; intron 6

  OTTHUMT00000378053 ; PTK2-005; intron 8

  OTTHUMT00000378053 ; PTK2-005; intron 8

  OTTHUMT00000378053 ; PTK2-005; intron 8

  OTTHUMT00000378057 ; PTK2-002; intron 12

  OTTHUMT00000378057 ; PTK2-002; intron 12

  OTTHUMT00000378057 ; PTK2-002; intron 12

  OTTHUMT00000378067 ; PTK2-009; intron 13

  OTTHUMT00000378067 ; PTK2-009; intron 13

  OTTHUMT00000378067 ; PTK2-009; intron 13

  OTTHUMT00000378056 ; PTK2-003; intron 17

  OTTHUMT00000378056 ; PTK2-003; intron 17

  OTTHUMT00000378056 ; PTK2-003; intron 17

  OTTHUMT00000378068 ; PTK2-010; intron 20

  OTTHUMT00000378068 ; PTK2-010; intron 20

  OTTHUMT00000378068 ; PTK2-010; intron 20

  OTTHUMT00000378062 ; PTK2-008; intron 21

  OTTHUMT00000378062 ; PTK2-008; intron 21

  OTTHUMT00000378062 ; PTK2-008; intron 21

  OTTHUMT00000378054 ; PTK2-001; intron 22

  OTTHUMT00000378540 ; PTK2-057; intron 22

  OTTHUMT00000378103 ; PTK2-011; intron 22

  OTTHUMT00000378104 ; PTK2-013; intron 22

  OTTHUMT00000378063 ; PTK2-007; intron 22

  OTTHUMT00000378054 ; PTK2-001; intron 22

  OTTHUMT00000378540 ; PTK2-057; intron 22

  OTTHUMT00000378103 ; PTK2-011; intron 22

  OTTHUMT00000378104 ; PTK2-013; intron 22

  OTTHUMT00000378063 ; PTK2-007; intron 22

  OTTHUMT00000378054 ; PTK2-001; intron 22

  OTTHUMT00000378540 ; PTK2-057; intron 22

  OTTHUMT00000378103 ; PTK2-011; intron 22

  OTTHUMT00000378104 ; PTK2-013; intron 22

  OTTHUMT00000378063 ; PTK2-007; intron 22

  ENST00000521250 ; PTK2-049; intron 3

  ENST00000521029 ; PTK2-051; intron 3

  ENST00000521250 ; PTK2-049; intron 3

  ENST00000521029 ; PTK2-051; intron 3

  ENST00000521250 ; PTK2-049; intron 3

  ENST00000521029 ; PTK2-051; intron 3

  ENST00000518509 ; PTK2-048; intron 4

  ENST00000518509 ; PTK2-048; intron 4

  ENST00000518509 ; PTK2-048; intron 4

  ENST00000521981 ; PTK2-052; intron 6

  ENST00000521981 ; PTK2-052; intron 6

  ENST00000521981 ; PTK2-052; intron 6

  ENST00000519465 ; PTK2-005; intron 8

  ENST00000519465 ; PTK2-005; intron 8

  ENST00000519465 ; PTK2-005; intron 8

  ENST00000523539 ; PTK2-002; intron 12

  ENST00000538769 ; PTK2-207; intron 12

  ENST00000523539 ; PTK2-002; intron 12

  ENST00000538769 ; PTK2-207; intron 12

  ENST00000523539 ; PTK2-002; intron 12

  ENST00000538769 ; PTK2-203; intron 12

  ENST00000521986 ; PTK2-009; intron 13

  ENST00000521986 ; PTK2-009; intron 13

  ENST00000521986 ; PTK2-009; intron 13

  ENST00000524202 ; PTK2-003; intron 17

  ENST00000524202 ; PTK2-003; intron 17

  ENST00000524202 ; PTK2-003; intron 17

  ENST00000519654 ; PTK2-010; intron 20

  ENST00000535192 ; PTK2-206; intron 20

  ENST00000519654 ; PTK2-010; intron 20

  ENST00000535192 ; PTK2-206; intron 20

  ENST00000519654 ; PTK2-010; intron 20

  ENST00000535192 ; PTK2-202; intron 20

  ENST00000517887 ; PTK2-008; intron 21

  ENST00000517887 ; PTK2-008; intron 21

  ENST00000517887 ; PTK2-008; intron 21

  ENST00000522684 ; PTK2-001; intron 22

  ENST00000521059 ; PTK2-057; intron 22

  ENST00000340930 ; PTK2-011; intron 22

  ENST00000519993 ; PTK2-013; intron 22

  ENST00000519419 ; PTK2-007; intron 22

  ENST00000395218 ; PTK2-204; intron 22

  ENST00000522684 ; PTK2-001; intron 22

  ENST00000521059 ; PTK2-057; intron 22

  ENST00000340930 ; PTK2-011; intron 22

  ENST00000519993 ; PTK2-013; intron 22

  ENST00000519419 ; PTK2-007; intron 22

  ENST00000395218 ; PTK2-204; intron 22

  ENST00000522684 ; PTK2-001; intron 22

  ENST00000521059 ; PTK2-057; intron 22

  ENST00000340930 ; PTK2-011; intron 22

  ENST00000519993 ; PTK2-013; intron 22

  ENST00000519419 ; PTK2-007; intron 22

  ENST00000395218 ; PTK2-201; intron 22

  ENST00000354438 ; PTK2-202; intron 24

  ENST00000395221 ; PTK2-205; intron 24

  ENST00000354438 ; PTK2-202; intron 24

  ENST00000395221 ; PTK2-205; intron 24

  ENST00000395214 ; PTK2-203; intron 25

  ENST00000395214 ; PTK2-203; intron 25

Database links

• ENTREZGENE: 442893;MIR151
• HGNC: 31762;MIR151

Mature sequence hsa-miR-151a-5p

• Accession: MIMAT0004697
• Previous IDs: hsa-miR-151-5p
• Sequence: 11 - ucgaggagcucacagucuagu - 31
• Deep sequencing: 10527 reads, 43 experiments
• Evidence: experimental; cloned [4-5]
• Validated targets:
  • TARBASE:hsa-miR-151a-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-151a-5p
  • MICRORNA.ORG:hsa-miR-151a-5p
  • MIRDB:hsa-miR-151a-5p
  • RNA22-HSA:hsa-miR-151a-5p
  • TARGETMINER:hsa-miR-151a-5p
  • TARGETSCAN-VERT:hsa-miR-151-5p
  • PICTAR-VERT:hsa-miR-151

Mature sequence hsa-miR-151a-3p

• Accession: MIMAT0000757
• Previous IDs: hsa-miR-151;hsa-miR-151-3p
• Sequence: 47 - cuagacugaagcuccuugagg - 67
• Deep sequencing: 27553 reads, 34 experiments
• Evidence: experimental; cloned [3-5], Northern [3]
• Validated targets:
  • TARBASE:hsa-miR-151a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-151a-3p
  • MICRORNA.ORG:hsa-miR-151a-3p
  • MIRDB:hsa-miR-151a-3p
  • RNA22-HSA:hsa-miR-151a-3p
  • TARGETMINER:hsa-miR-151a-3p
  • TARGETSCAN-VERT:hsa-miR-151-3p
  • PICTAR-VERT:hsa-miR-151

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).