Stem-loop sequence hsa-mir-151a

Accession

MI0000809

Previous IDs

hsa-mir-151

Symbol

HGNC:MIR151

Description

Homo sapiens miR-151a stem-loop

Gene family

MIPF0000057; mir-28

Stem-loop

   ---------------u      c            ca          u ucu 
5'                 uuccug ccucgaggagcu  cagucuagua g   c
                   |||||| ||||||||||||  |||||||||| |    
3'                 agggac ggaguuccucga  gucagaucau c   a
   cuccacucauacuggu      a            -a          c ccu 

Deep sequencing

130472 reads, 7.65e+03 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38): chr8: 140732564-140732653 [-]
• Overlapping transcripts:

  intergenic

Database links

• MIRBASE-TRACKER:MI0000809
• ENTREZGENE: 442893;MIR151
• HGNC: 31762;MIR151
• RNACENTRAL:URS00002ECE14/9606

Mature sequence hsa-miR-151a-5p

• Accession: MIMAT0004697
• Previous IDs: hsa-miR-151-5p
• Sequence: 11 - ucgaggagcucacagucuagu - 31
• Deep sequencing: 1505 reads, 68 experiments
• Evidence: experimental; cloned [4-5]
• Validated targets:
  • MIRTARBASE:hsa-miR-151a-5p
  • TARBASE:hsa-miR-151a-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-151a-5p
  • MICRORNA.ORG:hsa-miR-151a-5p
  • MIRDB:hsa-miR-151a-5p
  • RNA22-HSA:hsa-miR-151a-5p
  • TARGETMINER:hsa-miR-151a-5p
  • TARGETSCAN-VERT:hsa-miR-151-5p
  • PICTAR-VERT:hsa-miR-151

Mature sequence hsa-miR-151a-3p

• Accession: MIMAT0000757
• Previous IDs: hsa-miR-151;hsa-miR-151-3p
• Sequence: 47 - cuagacugaagcuccuugagg - 67
• Deep sequencing: 3037 reads, 57 experiments
• Evidence: experimental; cloned [3-5], Northern [3]
• Validated targets:
  • TARBASE:hsa-miR-151a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-151a-3p
  • MICRORNA.ORG:hsa-miR-151a-3p
  • MIRDB:hsa-miR-151a-3p
  • RNA22-HSA:hsa-miR-151a-3p
  • TARGETMINER:hsa-miR-151a-3p
  • TARGETSCAN-VERT:hsa-miR-151-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).