Stem-loop sequence hsa-mir-151a

AccessionMI0000809 (change log)
Previous IDshsa-mir-151
Symbol HGNC:MIR151A
DescriptionHomo sapiens miR-151a stem-loop
Gene family MIPF0000057; mir-28
Literature search

102 open access papers mention hsa-mir-151a
(492 sentences)

Stem-loop
   ---------------u      c            ca          u ucu 
5'                 uuccug ccucgaggagcu  cagucuagua g   c
                   |||||| ||||||||||||  |||||||||| |    
3'                 agggac ggaguuccucga  gucagaucau c   a
   cuccacucauacuggu      a            -a          c ccu 
Get sequence
Deep sequencing
1352751 reads, 4.89e+03 reads per million, 159 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 140732564-140732653 [-]
intergenic
Database links

Mature sequence hsa-miR-151a-5p

Accession MIMAT0004697
Previous IDshsa-miR-151-5p
Sequence

11 - 

ucgaggagcucacagucuagu

 - 31

Get sequence
Deep sequencing668216 reads, 159 experiments
Evidence experimental; cloned [4-5]
Database links
Predicted targets

Mature sequence hsa-miR-151a-3p

Accession MIMAT0000757
Previous IDshsa-miR-151;hsa-miR-151-3p
Sequence

47 - 

cuagacugaagcuccuugagg

 - 67

Get sequence
Deep sequencing684519 reads, 159 experiments
Evidence experimental; cloned [3-5], Northern [3]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).