![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-151a |
|||||
Accession | MI0000809 (change log) | ||||
Previous IDs | hsa-mir-151 | ||||
Symbol | HGNC:MIR151A | ||||
Description | Homo sapiens miR-151a stem-loop | ||||
Gene family | MIPF0000057; mir-28 | ||||
Literature search |
![]()
102 open access papers mention hsa-mir-151a | ||||
Stem-loop |
---------------u c ca u ucu 5' uuccug ccucgaggagcu cagucuagua g c |||||| |||||||||||| |||||||||| | 3' agggac ggaguuccucga gucagaucau c a cuccacucauacuggu a -a c ccu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-151a-5p |
|
Accession | MIMAT0004697 |
Previous IDs | hsa-miR-151-5p |
Sequence |
11 - ucgaggagcucacagucuagu - 31 |
Deep sequencing | 668216 reads, 159 experiments |
Evidence | experimental; cloned [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-151a-3p |
|
Accession | MIMAT0000757 |
Previous IDs | hsa-miR-151;hsa-miR-151-3p |
Sequence |
47 - cuagacugaagcuccuugagg - 67 |
Deep sequencing | 684519 reads, 159 experiments |
Evidence | experimental; cloned [3-5], Northern [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|