|
miRBase |
|
Stem-loop sequence hsa-mir-337 |
|||||
| Accession | MI0000806 | ||||
| Symbol | HGNC:MIR337 | ||||
| Description | Homo sapiens miR-337 stem-loop | ||||
| Gene family | MIPF0000195; mir-337 | ||||
| Stem-loop |
guagucagua uu - c u c - ca g ggggggugg gaa ggc ucaua aggaguug aug c | ||||||||| ||| ||| ||||| |||||||| ||| c uccccuacu cuu ccg aguau uccucgac uau a --------aa -u u u u a c ug |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence was predicted based on homology with a verified rat miRNA [1,2], and later confirmed in human [3]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-337-5p |
|
| Accession | MIMAT0004695 |
| Sequence |
23 - gaacggcuucauacaggaguu - 43 |
| Deep sequencing | 27 reads, 10 experiments |
| Evidence | experimental; cloned [3] |
| Predicted targets |
|
Mature sequence hsa-miR-337-3p |
|
| Accession | MIMAT0000754 |
| Previous IDs | hsa-miR-337 |
| Sequence |
61 - cuccuauaugaugccuuucuuc - 82 |
| Deep sequencing | 69 reads, 5 experiments |
| Evidence | experimental; cloned [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|