Stem-loop sequence hsa-mir-342

AccessionMI0000805
Symbol HGNC:MIR342
DescriptionHomo sapiens miR-342 stem-loop
Gene family MIPF0000190; mir-342
Stem-loop
   gaaac     u        g      --ua      auuga      ugg  a 
5'      ugggc caagguga gggugc    ucugug     gggaca   uu a
        ||||| |||||||| ||||||    ||||||     ||||||   ||  
3'      auccg guuccacu cccacg    agacac     cucugu   ag u
   -auuc     -        g      cuaa      ----a      -ua  g 
Get sequence
Deep sequencing
18471 reads, 1.39e+03 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was predicted by homology to a rat miRNA [1,2] and later verified in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 100109655-100109753 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-342
hsa-mir-151bchr14: 100109419-100109514 [-]
hsa-mir-342chr14: 100109655-100109753 [+]
Database links

Mature sequence hsa-miR-342-5p

Accession MIMAT0004694
Sequence

19 - 

aggggugcuaucugugauuga

 - 39

Get sequence
Deep sequencing3300 reads, 45 experiments
Evidence experimental; cloned [3-5], Northern [5]
Predicted targets

Mature sequence hsa-miR-342-3p

Accession MIMAT0000753
Previous IDshsa-miR-342
Sequence

61 - 

ucucacacagaaaucgcacccgu

 - 83

Get sequence
Deep sequencing2122 reads, 58 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).