Stem-loop sequence hsa-mir-342

Accession MI0000805
Symbol HGNC:MIR342
Description Homo sapiens miR-342 stem-loop
Gene family MIPF0000190; mir-342
Stem-loop 
gaaac     u        g      --ua      auuga      ugg  a 
     ugggc caagguga gggugc    ucugug     gggaca   uu a
     ||||| |||||||| ||||||    ||||||     ||||||   ||  
     auccg guuccacu cccacg    agacac     cucugu   ag u
-auuc     -        g      cuaa      ----a      -ua  g
Get sequence
Deep sequencing
1819 reads, 43 experiments
Comments

This sequence was predicted by homology to a rat miRNA [1,2] and later verified in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 100575992-100576090 [+]
sense
OTTHUMT00000413973 ; EVL-015; intron 2
OTTHUMT00000413973 ; EVL-015; intron 2
OTTHUMT00000413973 ; EVL-015; intron 2
OTTHUMT00000413958 ; EVL-006; intron 3
OTTHUMT00000413959 ; EVL-005; intron 3
OTTHUMT00000413962 ; EVL-001; intron 3
OTTHUMT00000413969 ; EVL-002; intron 3
OTTHUMT00000413971 ; EVL-011; intron 3
OTTHUMT00000413958 ; EVL-006; intron 3
OTTHUMT00000413959 ; EVL-005; intron 3
OTTHUMT00000413962 ; EVL-001; intron 3
OTTHUMT00000413969 ; EVL-002; intron 3
OTTHUMT00000413971 ; EVL-011; intron 3
OTTHUMT00000413958 ; EVL-006; intron 3
OTTHUMT00000413959 ; EVL-005; intron 3
OTTHUMT00000413962 ; EVL-001; intron 3
OTTHUMT00000413969 ; EVL-002; intron 3
OTTHUMT00000413971 ; EVL-011; intron 3
OTTHUMT00000413965 ; EVL-010; intron 4
OTTHUMT00000413968 ; EVL-014; intron 4
OTTHUMT00000413965 ; EVL-010; intron 4
OTTHUMT00000413968 ; EVL-014; intron 4
OTTHUMT00000413965 ; EVL-010; intron 4
OTTHUMT00000413968 ; EVL-014; intron 4
ENST00000557384 ; EVL-015; intron 2
ENST00000557384 ; EVL-015; intron 2
ENST00000557384 ; EVL-015; intron 2
ENST00000402714 ; EVL-006; intron 3
ENST00000544450 ; EVL-005; intron 3
ENST00000392920 ; EVL-001; intron 3
ENST00000554045 ; EVL-002; intron 3
ENST00000557153 ; EVL-011; intron 3
ENST00000539470 ; EVL-201; intron 3
ENST00000539470 ; EVL-201; intron 3
ENST00000554045 ; EVL-002; intron 3
ENST00000557153 ; EVL-011; intron 3
ENST00000392920 ; EVL-001; intron 3
ENST00000402714 ; EVL-006; intron 3
ENST00000544450 ; EVL-005; intron 3
ENST00000402714 ; EVL-006; intron 3
ENST00000544450 ; EVL-005; intron 3
ENST00000392920 ; EVL-001; intron 3
ENST00000554045 ; EVL-002; intron 3
ENST00000557153 ; EVL-011; intron 3
ENST00000555706 ; EVL-010; intron 4
ENST00000553875 ; EVL-014; intron 4
ENST00000553875 ; EVL-014; intron 4
ENST00000555706 ; EVL-010; intron 4
ENST00000555706 ; EVL-010; intron 4
ENST00000553875 ; EVL-014; intron 4
Clustered miRNAs
< 10kb from hsa-mir-342
hsa-mir-151b chr14: 100575756-100575851 [-]
hsa-mir-342 chr14: 100575992-100576090 [+]
Database links

Mature sequence hsa-miR-342-5p

Accession MIMAT0004694
Sequence

19 -  

aggggugcuaucugugauuga

 - 39

Get sequence
Deep sequencing 144 reads, 21 experiments
Evidence experimental; cloned [3-5], Northern [5]
Predicted targets

Mature sequence hsa-miR-342-3p

Accession MIMAT0000753
Previous IDs hsa-miR-342
Sequence

61 -  

ucucacacagaaaucgcacccgu

 - 83

Get sequence
Deep sequencing 1672 reads, 33 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).