Stem-loop sequence hsa-mir-328

Accession

MI0000804

Symbol

HGNC:MIR328

Description

Homo sapiens miR-328 stem-loop

Gene family

MIPF0000203; mir-328

Stem-loop

   --u  ag           ga     u     a aaa  g 
5'    gg  ugggggggcag  ggggc caggg g   gu c
      ||  |||||||||||  ||||| ||||| |   ||  
3'    cc  gccuucccguc  ucccg guccc c   ca a
   guc  cu           uc     -     - -ga  u 

Deep sequencing

4505 reads, 424 reads per million, 60 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context

• Coordinates (GRCh38): chr16: 67202321-67202395 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000375094 ; HSF4-028; intron 1

  OTTHUMT00000375090 ; HSF4-018; intron 3

  OTTHUMT00000375091 ; HSF4-019; intron 3

  OTTHUMT00000375092 ; HSF4-020; intron 3

  OTTHUMT00000375084 ; HSF4-027; intron 6

  OTTHUMT00000375072 ; HSF4-005; intron 8

  OTTHUMT00000375076 ; HSF4-009; intron 8

  OTTHUMT00000375077 ; HSF4-011; intron 8

  OTTHUMT00000375079 ; HSF4-012; intron 8

  OTTHUMT00000375073 ; HSF4-007; intron 9

  OTTHUMT00000375074 ; HSF4-008; intron 9

  OTTHUMT00000375078 ; HSF4-010; intron 9

  OTTHUMT00000375080 ; HSF4-006; intron 9

  OTTHUMT00000375068 ; HSF4-001; intron 9

  ENST00000520304 ; HSF4-028; intron 1

  ENST00000519601 ; HSF4-018; intron 3

  ENST00000520833 ; HSF4-019; intron 3

  ENST00000520528 ; HSF4-020; intron 3

  ENST00000517750 ; HSF4-027; intron 6

  ENST00000522870 ; HSF4-005; intron 8

  ENST00000521314 ; HSF4-009; intron 8

  ENST00000521624 ; HSF4-011; intron 8

  ENST00000517685 ; HSF4-012; intron 8

  ENST00000522295 ; HSF4-007; intron 9

  ENST00000434833 ; HSF4-008; intron 9

  ENST00000523562 ; HSF4-010; intron 9

  ENST00000521374 ; HSF4-006; intron 9

  ENST00000584272 ; HSF4-001; intron 9

  ENST00000264009 ; HSF4-201; intron 11

  ENST00000421453 ; HSF4-202; intron 11

Database links

• MIRBASE-TRACKER:MI0000804
• ENTREZGENE: 442901;MIR328
• HGNC: 31770;MIR328

Mature sequence hsa-miR-328-5p

• Accession: MIMAT0026486
• Sequence: 7 - gggggggcaggaggggcucaggg - 29
• Deep sequencing: 6 reads, 6 experiments
• Evidence: experimental; Illumina [4]
• Predicted targets:
  • PICTAR-VERT:hsa-miR-328

Mature sequence hsa-miR-328-3p

• Accession: MIMAT0000752
• Sequence: 48 - cuggcccucucugcccuuccgu - 69
• Deep sequencing: 204 reads, 40 experiments
• Evidence: experimental; cloned [3], Illumina [4]
• Validated targets:
  • TARBASE:hsa-miR-328-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-328-3p
  • MICRORNA.ORG:hsa-miR-328-3p
  • MIRDB:hsa-miR-328-3p
  • RNA22-HSA:hsa-miR-328-3p
  • TARGETSCAN-VERT:hsa-miR-328

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).