Stem-loop sequence hsa-mir-328

AccessionMI0000804 (change log)
Symbol HGNC:MIR328
DescriptionHomo sapiens miR-328 stem-loop
Gene family MIPF0000203; mir-328
Literature search

110 open access papers mention hsa-mir-328
(562 sentences)

Stem-loop 
   --u  ag           ga     u     a aaa  g 
5'    gg  ugggggggcag  ggggc caggg g   gu c
      ||  |||||||||||  ||||| ||||| |   ||  
3'    cc  gccuucccguc  ucccg guccc c   ca a
   guc  cu           uc     -     - -ga  u
Get sequence
Deep sequencing
26863 reads, 31.2 reads per million, 154 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 67202321-67202395 [-]
antisense
OTTHUMT00000375094 ; HSF4-028; intron 1
OTTHUMT00000375090 ; HSF4-018; intron 3
OTTHUMT00000375091 ; HSF4-019; intron 3
OTTHUMT00000375092 ; HSF4-020; intron 3
OTTHUMT00000375084 ; HSF4-027; intron 6
OTTHUMT00000375072 ; HSF4-005; intron 8
OTTHUMT00000375076 ; HSF4-009; intron 8
OTTHUMT00000375077 ; HSF4-011; intron 8
OTTHUMT00000375079 ; HSF4-012; intron 8
OTTHUMT00000375073 ; HSF4-007; intron 9
OTTHUMT00000375074 ; HSF4-008; intron 9
OTTHUMT00000375078 ; HSF4-010; intron 9
OTTHUMT00000375080 ; HSF4-006; intron 9
OTTHUMT00000375068 ; HSF4-001; intron 9
ENST00000520304 ; HSF4-028; intron 1
ENST00000519601 ; HSF4-018; intron 3
ENST00000520833 ; HSF4-019; intron 3
ENST00000520528 ; HSF4-020; intron 3
ENST00000517750 ; HSF4-027; intron 6
ENST00000522870 ; HSF4-005; intron 8
ENST00000521314 ; HSF4-009; intron 8
ENST00000521624 ; HSF4-011; intron 8
ENST00000517685 ; HSF4-012; intron 8
ENST00000522295 ; HSF4-007; intron 9
ENST00000434833 ; HSF4-008; intron 9
ENST00000523562 ; HSF4-010; intron 9
ENST00000521374 ; HSF4-006; intron 9
ENST00000584272 ; HSF4-001; intron 9
ENST00000264009 ; HSF4-201; intron 11
ENST00000421453 ; HSF4-202; intron 11
Database links

Mature sequence hsa-miR-328-5p

Accession MIMAT0026486
Sequence

7 -  

gggggggcaggaggggcucaggg

 - 29

Get sequence
Deep sequencing32 reads, 21 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence hsa-miR-328-3p

Accession MIMAT0000752
Sequence

48 -  

cuggcccucucugcccuuccgu

 - 69

Get sequence
Deep sequencing26824 reads, 154 experiments
Evidence experimental; cloned [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).