Stem-loop sequence hsa-mir-328

Accession MI0000804
Symbol HGNC:MIR328
Description Homo sapiens miR-328 stem-loop
Gene family MIPF0000203; mir-328
Stem-loop 
--u  ag           ga     u     a aaa  g 
   gg  ugggggggcag  ggggc caggg g   gu c
   ||  |||||||||||  ||||| ||||| |   ||  
   cc  gccuucccguc  ucccg guccc c   ca a
guc  cu           uc     -     - -ga  u
Get sequence
Deep sequencing
615 reads, 35 experiments
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 67236224-67236298 [-]
antisense
OTTHUMT00000257667 ; ELMO3-001; intron 12
OTTHUMT00000257668 ; ELMO3-002; intron 12
OTTHUMT00000257667 ; ELMO3-001; intron 12
OTTHUMT00000257668 ; ELMO3-002; intron 12
OTTHUMT00000257667 ; ELMO3-001; intron 12
OTTHUMT00000257668 ; ELMO3-002; intron 12
OTTHUMT00000257669 ; ELMO3-003; intron 13
OTTHUMT00000257669 ; ELMO3-003; intron 13
OTTHUMT00000257669 ; ELMO3-003; intron 13
ENST00000360833 ; ELMO3-001; intron 12
ENST00000477898 ; ELMO3-002; intron 12
ENST00000360833 ; ELMO3-001; intron 12
ENST00000477898 ; ELMO3-002; intron 12
ENST00000360833 ; ELMO3-001; intron 12
ENST00000477898 ; ELMO3-002; intron 12
ENST00000393997 ; ELMO3-003; intron 13
ENST00000393997 ; ELMO3-003; intron 13
ENST00000393997 ; ELMO3-003; intron 13
Database links

Mature sequence hsa-miR-328

Accession MIMAT0000752
Sequence

48 -  

cuggcccucucugcccuuccgu

 - 69

Get sequence
Deep sequencing 604 reads, 26 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).