![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-328 |
|||||
Accession | MI0000804 (change log) | ||||
Symbol | HGNC:MIR328 | ||||
Description | Homo sapiens miR-328 stem-loop | ||||
Gene family | MIPF0000203; mir-328 | ||||
Literature search |
![]()
110 open access papers mention hsa-mir-328 | ||||
Stem-loop |
--u ag ga u a aaa g 5' gg ugggggggcag ggggc caggg g gu c || ||||||||||| ||||| ||||| | || 3' cc gccuucccguc ucccg guccc c ca a guc cu uc - - -ga u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-328-5p |
|
Accession | MIMAT0026486 |
Sequence |
7 - gggggggcaggaggggcucaggg - 29 |
Deep sequencing | 32 reads, 21 experiments |
Evidence | experimental; Illumina [4] |
Predicted targets |
|
Mature sequence hsa-miR-328-3p |
|
Accession | MIMAT0000752 |
Sequence |
48 - cuggcccucucugcccuuccgu - 69 |
Deep sequencing | 26824 reads, 154 experiments |
Evidence | experimental; cloned [3], Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|