|
miRBase |
|
Stem-loop sequence hsa-mir-330 |
|||||
| Accession | MI0000803 | ||||
| Symbol | HGNC:MIR330 | ||||
| Description | Homo sapiens miR-330 stem-loop | ||||
| Gene family | MIPF0000200; mir-330 | ||||
| Stem-loop |
cuuu - u a -- - u ag ugcaa ggc ga c cugccucucug ggcc ugug cuu gcuc g ||| || | ||||||||||| |||| |||| ||| |||| a ccg cu g gacggagagac ccgg acac gaa cgag u ---c u c c gu c - -a ccaac |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-330-5p |
|
| Accession | MIMAT0004693 |
| Sequence |
18 - ucucugggccugugucuuaggc - 39 |
| Deep sequencing | 25 reads, 8 experiments |
| Evidence | experimental; cloned [3-4] |
| Predicted targets |
|
Mature sequence hsa-miR-330-3p |
|
| Accession | MIMAT0000751 |
| Previous IDs | hsa-miR-330 |
| Sequence |
57 - gcaaagcacacggccugcagaga - 79 |
| Deep sequencing | 15831 reads, 24 experiments |
| Evidence | experimental; cloned [3] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|