Stem-loop sequence hsa-mir-330

Accession MI0000803
Symbol HGNC:MIR330
Description Homo sapiens miR-330 stem-loop
Gene family MIPF0000200; mir-330
Stem-loop
cuuu   -  u a           --    -    u   ag    ugcaa 
    ggc ga c cugccucucug  ggcc ugug cuu  gcuc     g
    ||| || | |||||||||||  |||| |||| |||  ||||     a
    ccg cu g gacggagagac  ccgg acac gaa  cgag     u
---c   u  c c           gu    c    -   -a    ccaac 
Get sequence
Deep sequencing
15856 reads, 26 experiments
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 46142252-46142345 [-]
sense
ENST00000245925 ; EML2-201; intron 1
ENST00000245925 ; EML2-201; intron 1
ENST00000245925 ; EML2-201; intron 1
ENST00000448055 ; EML2-203; intron 4
ENST00000536630 ; EML2-204; intron 4
ENST00000399594 ; EML2-202; intron 4
ENST00000448055 ; EML2-203; intron 4
ENST00000536630 ; EML2-204; intron 4
ENST00000399594 ; EML2-202; intron 4
ENST00000536630 ; EML2-203; intron 4
ENST00000399594 ; EML2-202; intron 4
Database links

Mature sequence hsa-miR-330-5p

Accession MIMAT0004693
Sequence

18 - 

ucucugggccugugucuuaggc

 - 39

Get sequence
Deep sequencing 25 reads, 8 experiments
Evidence experimental; cloned [3-4]
Predicted targets

Mature sequence hsa-miR-330-3p

Accession MIMAT0000751
Previous IDs hsa-miR-330
Sequence

57 - 

gcaaagcacacggccugcagaga

 - 79

Get sequence
Deep sequencing 15831 reads, 24 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).