Stem-loop sequence hsa-mir-340

AccessionMI0000802 (change log)
Symbol HGNC:MIR340
DescriptionHomo sapiens miR-340 stem-loop
Gene family MIPF0000191; mir-340
Literature search

75 open access papers mention hsa-mir-340
(421 sentences)

Stem-loop
   --uu     u      au       -caa      u    g     ug 
5'     guacc ggugug  uauaaag    ugagac gauu ucaua  u
       ||||| ||||||  |||||||    |||||| |||| |||||  c
3'     uaugg ccauac  auauuuc    acucug cuag ggugu  g
   auuc     u      cg       auug      c    -     uu 
Get sequence
Deep sequencing
359849 reads, 914 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Landgraf et al. show that the 5' product is the predominant one in human, mouse and rat [3], in contrast to the previous annotation. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 180015303-180015397 [-]
intergenic
Database links

Mature sequence hsa-miR-340-5p

Accession MIMAT0004692
Previous IDshsa-miR-340
Sequence

16 - 

uuauaaagcaaugagacugauu

 - 37

Get sequence
Deep sequencing350491 reads, 159 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-340-3p

Accession MIMAT0000750
Previous IDshsa-miR-340;hsa-miR-340*
Sequence

58 - 

uccgucucaguuacuuuauagc

 - 79

Get sequence
Deep sequencing9260 reads, 136 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).