Stem-loop sequence hsa-mir-340

Accession MI0000802
Symbol HGNC:MIR340
Description Homo sapiens miR-340 stem-loop
Gene family MIPF0000191; mir-340
Stem-loop 
--uu     u      au       -caa      u    g     ug 
    guacc ggugug  uauaaag    ugagac gauu ucaua  u
    ||||| ||||||  |||||||    |||||| |||| |||||  c
    uaugg ccauac  auauuuc    acucug cuag ggugu  g
auuc     u      cg       auug      c    -     uu
Get sequence
Deep sequencing
27570 reads, 25 experiments
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Landgraf et al. show that the 5' product is the predominant one in human, mouse and rat [3], in contrast to the previous annotation. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 179442303-179442397 [-]
sense
OTTHUMT00000374206 ; RNF130-004; intron 2
OTTHUMT00000253499 ; RNF130-001; intron 2
OTTHUMT00000374205 ; RNF130-003; intron 2
OTTHUMT00000374204 ; RNF130-002; intron 2
OTTHUMT00000374206 ; RNF130-004; intron 2
OTTHUMT00000253499 ; RNF130-001; intron 2
OTTHUMT00000374205 ; RNF130-003; intron 2
OTTHUMT00000374204 ; RNF130-002; intron 2
OTTHUMT00000374206 ; RNF130-004; intron 2
OTTHUMT00000253499 ; RNF130-001; intron 2
OTTHUMT00000374205 ; RNF130-003; intron 2
OTTHUMT00000374204 ; RNF130-002; intron 2
ENST00000522208 ; RNF130-004; intron 2
ENST00000521389 ; RNF130-001; intron 2
ENST00000261947 ; RNF130-003; intron 2
ENST00000520911 ; RNF130-002; intron 2
ENST00000522208 ; RNF130-004; intron 2
ENST00000521389 ; RNF130-001; intron 2
ENST00000261947 ; RNF130-003; intron 2
ENST00000520911 ; RNF130-002; intron 2
ENST00000522208 ; RNF130-004; intron 2
ENST00000521389 ; RNF130-001; intron 2
ENST00000261947 ; RNF130-003; intron 2
ENST00000520911 ; RNF130-002; intron 2
Database links

Mature sequence hsa-miR-340-5p

Accession MIMAT0004692
Previous IDs hsa-miR-340
Sequence

16 -  

uuauaaagcaaugagacugauu

 - 37

Get sequence
Deep sequencing 27534 reads, 18 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-340-3p

Accession MIMAT0000750
Previous IDs hsa-miR-340;hsa-miR-340*
Sequence

58 -  

uccgucucaguuacuuuauagc

 - 79

Get sequence
Deep sequencing 31 reads, 10 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).