Stem-loop sequence cel-lsy-6

AccessionMI0000801 (change log)
DescriptionCaenorhabditis elegans lsy-6 stem-loop
Gene family MIPF0000265; lsy-6
Literature search

16 open access papers mention cel-lsy-6
(105 sentences)

Stem-loop
   c    -          a   u       a   aaaaa 
5'  cauc aaaugcgucu gua caaaauc ugu     c
    |||| |||||||||| ||| ||||||| |||      
3'  guag uuuacgcaga uau guuuuag aca     u
   a    c          g   -       -   aaaug 
Get sequence
Deep sequencing
497 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 10647232-10647304 [+]
intergenic
Database links

Mature sequence cel-lsy-6-5p

Accession MIMAT0031896
Sequence

6 - 

aaaugcgucuaguaucaaaau

 - 26

Get sequence
Evidence experimental; Illumina [4]

Mature sequence cel-lsy-6-3p

Accession MIMAT0000749
Previous IDscel-lsy-6
Sequence

49 - 

uuuuguaugagacgcauuucga

 - 70

Get sequence
Deep sequencing494 reads, 17 experiments
Evidence experimental; cloned [2], PCR [2], Illumina [3-4]
Database links
Predicted targets

References

1
2
3
4
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).