Stem-loop sequence mmu-mir-382

AccessionMI0000799 (change log)
Symbol MGI:Mir382
DescriptionMus musculus miR-382 stem-loop
Gene family MIPF0000018; mir-154
Literature search

28 open access papers mention mmu-mir-382
(214 sentences)

Stem-loop
       u       -a           ug      - uuu 
5' uacu gaagaga  guuguucgugg  gauucg c   a
   |||| |||||||  |||||||||||  |||||| |   c
3' auga cuuuuuu  caacaggcacu  cuaagc g   u
       -       ca           ua      a ugu 
Get sequence
Deep sequencing
286121 reads, 575 reads per million, 96 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109733771-109733846 [+]
sense
OTTMUST00000114051 ; Mirg-010; exon 4
OTTMUST00000114052 ; Mirg-009; exon 5
OTTMUST00000114049 ; Mirg-011; exon 8
ENSMUST00000083494 ; Mir382-201; exon 1
ENSMUST00000182185 ; Mirg-010; exon 4
ENSMUST00000182499 ; Mirg-009; exon 5
ENSMUST00000183144 ; Mirg-011; exon 8
Clustered miRNAs
< 10kb from mmu-mir-382
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
Database links

Mature sequence mmu-miR-382-5p

Accession MIMAT0000747
Previous IDsmmu-miR-382
Sequence

11 - 

gaaguuguucgugguggauucg

 - 32

Get sequence
Deep sequencing252055 reads, 91 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-382-3p

Accession MIMAT0004691
Previous IDsmmu-miR-382*
Sequence

49 - 

ucauucacggacaacacuuuuu

 - 70

Get sequence
Deep sequencing34066 reads, 91 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).