|
miRBase |
|
Stem-loop sequence mmu-mir-380 |
|||||
| Accession | MI0000797 | ||||
| Symbol | MGI:Mir380 | ||||
| Description | Mus musculus miR-380 stem-loop | ||||
| Gene family | MIPF0000126; mir-379 | ||||
| Stem-loop |
guu ga c u aagaug gaccaua acaugcg uac u |||||| ||||||| ||||||| ||| uucuac cugguau uguaugc gug c -ac ga u u |
||||
| Deep sequencing |
| ||||
| Comments |
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including a sequence from the 3' arm of this precursor [1]. Poy et al. cloned a sequence from the 5' arm from mouse pancreatic beta cell line MIN6 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-380-5p |
|
| Accession | MIMAT0000744 |
| Sequence |
4 - augguugaccauagaacaugcg - 25 |
| Deep sequencing | 4480 reads, 43 experiments |
| Evidence | experimental; cloned [2-3], Solexa [4-5] |
| Predicted targets |
|
Mature sequence mmu-miR-380-3p |
|
| Accession | MIMAT0000745 |
| Sequence |
40 - uauguaguaugguccacaucuu - 61 |
| Deep sequencing | 25158 reads, 49 experiments |
| Evidence | experimental; Northern [1], PCR [1], cloned [3], Solexa [4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
| 2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|