Stem-loop sequence mmu-mir-380

Accession MI0000797
Symbol MGI:Mir380
Description Mus musculus miR-380 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
      guu       ga       c   u 
aagaug   gaccaua  acaugcg uac u
||||||   |||||||  ||||||| |||  
uucuac   cugguau  uguaugc gug c
      -ac       ga       u   u 
Get sequence
Deep sequencing
29646 reads, 55 experiments
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including a sequence from the 3' arm of this precursor [1]. Poy et al. cloned a sequence from the 5' arm from mouse pancreatic beta cell line MIN6 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 109711803-109711863 [+]
antisense
ENSMUST00000175483 ; AC121784.3-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-380
mmu-mir-379 chr12: 109709060-109709125 [+]
mmu-mir-411 chr12: 109710175-109710256 [+]
mmu-mir-299a chr12: 109710638-109710700 [+]
mmu-mir-299b chr12: 109710645-109710693 [-]
mmu-mir-380 chr12: 109711803-109711863 [+]
mmu-mir-1197 chr12: 109712317-109712436 [+]
mmu-mir-323 chr12: 109712508-109712593 [+]
mmu-mir-758 chr12: 109712810-109712890 [+]
mmu-mir-329 chr12: 109713481-109713577 [+]
mmu-mir-494 chr12: 109715318-109715402 [+]
mmu-mir-679 chr12: 109715577-109715650 [+]
mmu-mir-1193 chr12: 109715671-109715791 [+]
mmu-mir-666 chr12: 109717085-109717183 [+]
mmu-mir-543 chr12: 109717258-109717333 [+]
mmu-mir-495 chr12: 109718754-109718816 [+]
mmu-mir-667 chr12: 109720006-109720097 [+]
Database links

Mature sequence mmu-miR-380-5p

Accession MIMAT0000744
Sequence

4 - 

augguugaccauagaacaugcg

 - 25

Get sequence
Deep sequencing 4480 reads, 43 experiments
Evidence experimental; cloned [2-3], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-380-3p

Accession MIMAT0000745
Sequence

40 - 

uauguaguaugguccacaucuu

 - 61

Get sequence
Deep sequencing 25158 reads, 49 experiments
Evidence experimental; Northern [1], PCR [1], cloned [3], Solexa [4]
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).