Stem-loop sequence mmu-mir-378a

AccessionMI0000795 (change log)
Previous IDsmmu-mir-378
Symbol MGI:Mir378a
DescriptionMus musculus miR-378 stem-loop
Gene family MIPF0000168; mir-378
Stem-loop
      g  c              ugu      ccu 
5' agg cu cugacuccaggucc   guguua   c
   ||| || ||||||||||||||   ||||||    
3' ucc ga gacugagguucagg   cacgau   g
      g  a              --u      aaa 
Get sequence
Deep sequencing
3937417 reads, 1.2e+04 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 61397835-61397900 [-]
sense
OTTMUST00000058693 ; Ppargc1b-001; intron 1
OTTMUST00000058872 ; Ppargc1b-002; intron 1
OTTMUST00000059063 ; Ppargc1b-003; intron 1
ENSMUST00000075299 ; Ppargc1b-001; intron 1
ENSMUST00000063307 ; Ppargc1b-002; intron 1
ENSMUST00000142134 ; Ppargc1b-003; intron 1
antisense
ENSMUST00000175285 ; Gm25301-201; exon 1
Database links

Mature sequence mmu-miR-378a-5p

Accession MIMAT0000742
Previous IDsmmu-miR-378;mmu-miR-378*;mmu-miR-378-5p
Sequence

5 - 

cuccugacuccagguccugugu

 - 26

Get sequence
Deep sequencing4936 reads, 71 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-378a-3p

Accession MIMAT0003151
Previous IDsmmu-miR-422b;mmu-miR-378;mmu-miR-378-3p
Sequence

43 - 

acuggacuuggagucagaagg

 - 63

Get sequence
Deep sequencing3932479 reads, 76 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).