Stem-loop sequence mmu-mir-377

AccessionMI0000794 (change log)
Symbol MGI:Mir377
DescriptionMus musculus miR-377 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u              c   -    a    - uuu 
5'  gagcagagguugcc uug guga uucg c   a
    |||||||||||||| ||| |||| |||| |   u
3'  uuuguuuucaacgg aac cacu aagu g   u
   g              a   a    -    u uag 
Get sequence
Deep sequencing
23027 reads, 311 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109740510-109740577 [+]
sense
OTTMUST00000113366 ; Mirg-004; intron 2
OTTMUST00000113367 ; Mirg-001; intron 2
OTTMUST00000113370 ; Mirg-002; exon 2
OTTMUST00000113368 ; Mirg-005; intron 3
OTTMUST00000114051 ; Mirg-010; intron 7
OTTMUST00000114052 ; Mirg-009; intron 9
OTTMUST00000114049 ; Mirg-011; intron 11
ENSMUST00000182268 ; Mirg-004; intron 2
ENSMUST00000181543 ; Mirg-001; intron 2
ENSMUST00000181496 ; Mirg-002; exon 2
ENSMUST00000183116 ; Mirg-005; intron 3
ENSMUST00000182185 ; Mirg-010; intron 7
ENSMUST00000182499 ; Mirg-009; intron 9
ENSMUST00000183144 ; Mirg-011; intron 11
Clustered miRNAs
< 10kb from mmu-mir-377
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-377-5p

Accession MIMAT0017079
Previous IDsmmu-miR-377*
Sequence

6 - 

agagguugcccuuggugaauuc

 - 27

Get sequence
Deep sequencing884 reads, 33 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-377-3p

Accession MIMAT0000741
Previous IDsmmu-miR-377
Sequence

44 - 

aucacacaaaggcaacuuuugu

 - 65

Get sequence
Deep sequencing22143 reads, 45 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).