Stem-loop sequence mmu-mir-376a

AccessionMI0000793 (change log)
Symbol MGI:Mir376a
DescriptionMus musculus miR-376a stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
   u    g  a    c    u      guacaaua 
5'  aaaa gu gauu uccu cuauga        u
    |||| || |||| |||| ||||||        u
3'  uuuu ca cuaa agga gaugcu        a
   c    g  c    a    -      aaucagua 
Get sequence
Deep sequencing
106732 reads, 1.36e+03 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The expression of miR-376a was independently verified by Poy et al. [2]. The mature miR-376a products have been shown to be modified by A to I edits [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109723781-109723848 [+]
antisense
ENSMUST00000175477 ; Gm25252-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-376a
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-376cchr12: 109722718-109722803 [+]
mmu-mir-654chr12: 109723218-109723301 [+]
mmu-mir-376bchr12: 109723458-109723539 [+]
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
Database links

Mature sequence mmu-miR-376a-5p

Accession MIMAT0003387
Previous IDsmmu-miR-376a*
Sequence

6 - 

gguagauucuccuucuaugagu

 - 27

Get sequence
Deep sequencing5759 reads, 37 experiments
Evidence experimental; cloned [3,5], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-376a-3p

Accession MIMAT0000740
Previous IDsmmu-miR-376a
Sequence

44 - 

aucguagaggaaaauccacgu

 - 64

Get sequence
Deep sequencing100960 reads, 52 experiments
Evidence experimental; Northern [1], PCR [1], cloned [2-3,5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4
PMID:17322061 "Redirection of silencing targets by adenosine-to-inosine editing of miRNAs" Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K Science. 315:1137-1140(2007).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).