Stem-loop sequence mmu-mir-375

AccessionMI0000792 (change log)
Symbol MGI:Mir375
DescriptionMus musculus miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

113 open access papers mention mmu-mir-375
(1343 sentences)

Stem-loop
   c  -    a      ccu  c     c  gac 
5'  cc cgcg cgagcc   cg acaaa cg   c
    || |||| ||||||   || ||||| ||    
3'  gg gugc gcucgg   gc uguuu gc   u
   c  a    -      cuu  u     u  gag 
Get sequence
Deep sequencing
412610 reads, 1.64e+03 reads per million, 96 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 74900658-74900721 [-]
sense
ENSMUST00000083682 ; Mir375-201; exon 1
Database links

Mature sequence mmu-miR-375-5p

Accession MIMAT0017078
Previous IDsmmu-miR-375*
Sequence

5 - 

gcgacgagccccucgcacaaac

 - 26

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence mmu-miR-375-3p

Accession MIMAT0000739
Previous IDsmmu-miR-375
Sequence

40 - 

uuuguucguucggcucgcguga

 - 61

Get sequence
Deep sequencing412606 reads, 96 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).