Stem-loop sequence hsa-mir-383

AccessionMI0000791 (change log)
Symbol HGNC:MIR383
DescriptionHomo sapiens miR-383 stem-loop
Gene family MIPF0000137; mir-383
Literature search

31 open access papers mention hsa-mir-383
(288 sentences)

Stem-loop
      -c  a      aa    a        uug   gga 
5' cuc  uc gaucag  ggug uuguggcu   ggu   u
   |||  || ||||||  |||| ||||||||   |||    
3' gag  ag cugguc  ucac gacaccga   cua   a
      aa  a      cg    -        ---   auu 
Get sequence
Deep sequencing
5864 reads, 8 reads per million, 100 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 14853438-14853510 [-]
sense
OTTHUMT00000207636 ; SGCZ-001; intron 1
ENST00000382080 ; SGCZ-001; intron 1
Database links

Mature sequence hsa-miR-383-5p

Accession MIMAT0000738
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Deep sequencing5837 reads, 100 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-383-3p

Accession MIMAT0026485
Sequence

50 - 

acagcacugccuggucaga

 - 68

Get sequence
Deep sequencing26 reads, 14 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).