Stem-loop sequence hsa-mir-383

AccessionMI0000791
Symbol HGNC:MIR383
DescriptionHomo sapiens miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
      -c  a      aa    a        uug   gga 
5' cuc  uc gaucag  ggug uuguggcu   ggu   u
   |||  || ||||||  |||| ||||||||   |||    
3' gag  ag cugguc  ucac gacaccga   cua   a
      aa  a      cg    -        ---   auu 
Get sequence
Deep sequencing
2642 reads, 196 reads per million, 17 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr8: 14853438-14853510 [-]
sense
OTTHUMT00000207636 ; SGCZ-001; intron 1
ENST00000382080 ; SGCZ-001; intron 1
Database links

Mature sequence hsa-miR-383-5p

Accession MIMAT0000738
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Deep sequencing149 reads, 7 experiments
Evidence experimental; cloned [2], Illumina [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-383-3p

Accession MIMAT0026485
Sequence

50 - 

acagcacugccuggucaga

 - 68

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [3]

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).