|
miRBase |
|
Mature sequence hsa-miR-382-5p |
|
| Accession | MIMAT0000737 |
| Previous IDs | hsa-miR-382 |
| Sequence |
11 - gaaguuguucgugguggauucg - 32 |
| Deep sequencing | 752 reads, 17 experiments |
| Evidence | experimental; cloned [1-3] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-382-3p |
|
| Accession | MIMAT0022697 |
| Sequence |
47 - aaucauucacggacaacacuu - 67 |
| Deep sequencing | 1166 reads, 4 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|