Stem-loop sequence hsa-mir-382

AccessionMI0000790 (change log)
Symbol HGNC:MIR382
DescriptionHomo sapiens miR-382 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
       u       -a           ug      - uuu 
5' uacu gaagaga  guuguucgugg  gauucg c   a
   |||| |||||||  |||||||||||  |||||| |   c
3' auga cuuuuuu  caacaggcacu  cuaagc g   u
       -       ca           ua      a uau 
Get sequence
Deep sequencing
4094 reads, 25 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101054306-101054381 [+]
antisense
OTTHUMT00000414339 ; CTD-2644I21.1-001; exon 2
ENST00000554540 ; CTD-2644I21.1-001; exon 2
Clustered miRNAs
< 10kb from hsa-mir-382
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
Database links

Mature sequence hsa-miR-382-5p

Accession MIMAT0000737
Previous IDshsa-miR-382
Sequence

11 - 

gaaguuguucgugguggauucg

 - 32

Get sequence
Deep sequencing2088 reads, 38 experiments
Evidence experimental; cloned [1-3]
Database links
Predicted targets

Mature sequence hsa-miR-382-3p

Accession MIMAT0022697
Sequence

47 - 

aaucauucacggacaacacuu

 - 67

Get sequence
Deep sequencing2005 reads, 34 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).