Stem-loop sequence hsa-mir-381

AccessionMI0000789 (change log)
Symbol HGNC:MIR381
DescriptionHomo sapiens miR-381 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         a  c   g        u        --g   u 
5' uacuua ag gag uugcccuu guauauuc   guu a
   |||||| || ||| |||||||| ||||||||   |||  
3' augagu uc cuc aacgggaa cauauaag   cag u
         g  u   g        -        gua   u 
Get sequence
Deep sequencing
1655 reads, 20.4 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101045920-101045994 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-381
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
Database links

Mature sequence hsa-miR-381-5p

Accession MIMAT0022862
Sequence

8 - 

agcgagguugcccuuuguauau

 - 29

Get sequence
Deep sequencing94 reads, 27 experiments
Evidence experimental; SOLiD [3]
Database links
Predicted targets

Mature sequence hsa-miR-381-3p

Accession MIMAT0000736
Previous IDshsa-miR-381
Sequence

49 - 

uauacaagggcaagcucucugu

 - 70

Get sequence
Deep sequencing1560 reads, 46 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).