|
miRBase |
|
Stem-loop sequence hsa-mir-379 |
|||||
| Accession | MI0000787 | ||||
| Symbol | HGNC:MIR379 | ||||
| Description | Homo sapiens miR-379 stem-loop | ||||
| Gene family | MIPF0000126; mir-379 | ||||
| Stem-loop |
a a ga - uu u agag uggu gacuaug acguagg cg a g |||| |||| ||||||| ||||||| || | ucuc auca cugguac uguaucc gu u a a c aa a cu u |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-379-5p |
|
| Accession | MIMAT0000733 |
| Previous IDs | hsa-miR-379 |
| Sequence |
6 - ugguagacuauggaacguagg - 26 |
| Deep sequencing | 686 reads, 12 experiments |
| Evidence | experimental; cloned [2-4] |
| Predicted targets |
|
Mature sequence hsa-miR-379-3p |
|
| Accession | MIMAT0004690 |
| Previous IDs | hsa-miR-379* |
| Sequence |
44 - uauguaacaugguccacuaacu - 65 |
| Deep sequencing | 168 reads, 8 experiments |
| Evidence | experimental; cloned [4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
| 2 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
| 3 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|