Stem-loop sequence hsa-mir-378a

Accession MI0000786
Previous IDs hsa-mir-378
Symbol HGNC:MIR378
Description Homo sapiens miR-378a stem-loop
Gene family MIPF0000168; mir-378
Stem-loop 
   g  c              ugu      ccu 
agg cu cugacuccaggucc   guguua   a
||| || ||||||||||||||   ||||||    
ucc ga gacugagguucagg   cacgau   g
   g  a              --u      aaa
Get sequence
Deep sequencing
reads, experiments
Comments

miR-422b was the most abundant miRNA cloned from human promyelocytic leukemia (HL-60) cells [2]. The sequence originates from the opposite arm of the human homologue of previously identified mouse mir-378 [1]. Landgraf et al. show that the 3' product (previously called miR-422b) is the predominant one [3]. Further, mir-378 and mir-422a loci are unrelated. miR-422b is thus renamed miR-378 here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 149112388-149112453 [+]
sense
OTTHUMT00000319319 ; PPARGC1B-005; intron 1
OTTHUMT00000319317 ; PPARGC1B-003; intron 1
OTTHUMT00000319320 ; PPARGC1B-006; intron 1
OTTHUMT00000252334 ; PPARGC1B-001; intron 1
OTTHUMT00000319319 ; PPARGC1B-005; intron 1
OTTHUMT00000319317 ; PPARGC1B-003; intron 1
OTTHUMT00000319320 ; PPARGC1B-006; intron 1
OTTHUMT00000252334 ; PPARGC1B-001; intron 1
OTTHUMT00000319319 ; PPARGC1B-005; intron 1
OTTHUMT00000319317 ; PPARGC1B-003; intron 1
OTTHUMT00000319320 ; PPARGC1B-006; intron 1
OTTHUMT00000252334 ; PPARGC1B-001; intron 1
ENST00000360453 ; PPARGC1B-005; intron 1
ENST00000394320 ; PPARGC1B-003; intron 1
ENST00000461780 ; PPARGC1B-006; intron 1
ENST00000309241 ; PPARGC1B-001; intron 1
ENST00000360453 ; PPARGC1B-005; intron 1
ENST00000394320 ; PPARGC1B-003; intron 1
ENST00000461780 ; PPARGC1B-006; intron 1
ENST00000309241 ; PPARGC1B-001; intron 1
ENST00000360453 ; PPARGC1B-005; intron 1
ENST00000394320 ; PPARGC1B-003; intron 1
ENST00000461780 ; PPARGC1B-006; intron 1
ENST00000309241 ; PPARGC1B-001; intron 1
Database links

Mature sequence hsa-miR-378a-5p

Accession MIMAT0000731
Previous IDs hsa-miR-378;hsa-miR-378*
Sequence

5 -  

cuccugacuccagguccugugu

 - 26

Get sequence
Evidence experimental; cloned [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-378a-3p

Accession MIMAT0000732
Previous IDs hsa-miR-422b;hsa-miR-378
Sequence

43 -  

acuggacuuggagucagaagg

 - 63

Get sequence
Evidence experimental; cloned [2-3], Northern [2]
Validated targets
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).