Stem-loop sequence hsa-mir-378a

AccessionMI0000786
Previous IDshsa-mir-378
Symbol HGNC:MIR378
DescriptionHomo sapiens miR-378a stem-loop
Gene family MIPF0000168; mir-378
Stem-loop
      g  c              ugu      ccu 
5' agg cu cugacuccaggucc   guguua   a
   ||| || ||||||||||||||   ||||||    
3' ucc ga gacugagguucagg   cacgau   g
      g  a              --u      aaa 
Get sequence
Deep sequencing
116358 reads, 7.03e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-422b was the most abundant miRNA cloned from human promyelocytic leukemia (HL-60) cells [2]. The sequence originates from the opposite arm of the human homologue of previously identified mouse mir-378 [1]. Landgraf et al. show that the 3' product (previously called miR-422b) is the predominant one [3]. Further, mir-378 and mir-422a loci are unrelated. miR-422b is thus renamed miR-378 here.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr5: 149732825-149732890 [+]
intergenic
Database links

Mature sequence hsa-miR-378a-5p

Accession MIMAT0000731
Previous IDshsa-miR-378;hsa-miR-378*
Sequence

5 - 

cuccugacuccagguccugugu

 - 26

Get sequence
Deep sequencing276 reads, 47 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-378a-3p

Accession MIMAT0000732
Previous IDshsa-miR-422b;hsa-miR-378
Sequence

43 - 

acuggacuuggagucagaaggc

 - 64

Get sequence
Deep sequencing15382 reads, 68 experiments
Evidence experimental; cloned [2-3], Northern [2]
Validated targets
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).