Stem-loop sequence hsa-mir-377

AccessionMI0000785
Symbol HGNC:MIR377
DescriptionHomo sapiens miR-377 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   uu              c   -    a    - uuu 
5'   gagcagagguugcc uug guga uucg c   a
     |||||||||||||| ||| |||| |||| |   u
3'   uuuguuuucaacgg aac cacu aagu g   u
   -g              a   a    -    u uau 
Get sequence
Deep sequencing
764 reads, 325 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 101062050-101062118 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-377
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-377-5p

Accession MIMAT0004689
Previous IDshsa-miR-377*
Sequence

7 - 

agagguugcccuuggugaauuc

 - 28

Get sequence
Deep sequencing39 reads, 13 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-377-3p

Accession MIMAT0000730
Previous IDshsa-miR-377
Sequence

45 - 

aucacacaaaggcaacuuuugu

 - 66

Get sequence
Deep sequencing234 reads, 30 experiments
Evidence experimental; cloned [1-3]
Validated targets
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).