Stem-loop sequence hsa-mir-375

AccessionMI0000783 (change log)
Symbol HGNC:MIR375
DescriptionHomo sapiens miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

256 open access papers mention hsa-mir-375
(1712 sentences)

Stem-loop
   c  -    a      ccu  c     c  gac 
5'  cc cgcg cgagcc   cg acaaa cg   c
    || |||| ||||||   || ||||| ||    
3'  gg gugc gcucgg   gc uguuu gc   u
   c  a    -      cuu  u     u  gag 
Get sequence
Deep sequencing
1912597 reads, 3.42e+03 reads per million, 142 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 219001645-219001708 [-]
antisense
OTTHUMT00000256772 ; CXCR2-001; exon 3
ENST00000318507 ; CXCR2-001; exon 3
Database links

Mature sequence hsa-miR-375-5p

Accession MIMAT0037313
Sequence

5 - 

gcgacgagccccucgcacaaacc

 - 27

Get sequence
Deep sequencing1757 reads, 43 experiments
Evidence not experimental

Mature sequence hsa-miR-375-3p

Accession MIMAT0000728
Sequence

40 - 

uuuguucguucggcucgcguga

 - 61

Get sequence
Deep sequencing1910831 reads, 142 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).