Stem-loop sequence hsa-mir-374a

AccessionMI0000782
Previous IDshsa-mir-374
Symbol HGNC:MIR374A
DescriptionHomo sapiens miR-374a stem-loop
Gene family MIPF0000288; mir-374
Stem-loop
        c   c            c           u 
5' uacau ggc auuauaauacaa cugauaagugu a
   ||||| ||| |||||||||||| |||||||||||  
3' augug cug uaauguuauguu gacuauucacg u
        u   u            a           a 
Get sequence
Deep sequencing
39649 reads, 2.01e+03 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 74287286-74287357 [-]
sense
OTTHUMT00000394108 ; ABCB7-009; intron 6
OTTHUMT00000394107 ; ABCB7-006; intron 11
OTTHUMT00000394029 ; ABCB7-005; intron 11
OTTHUMT00000057273 ; ABCB7-001; intron 12
OTTHUMT00000057274 ; ABCB7-002; intron 12
ENST00000534570 ; ABCB7-009; intron 6
ENST00000339447 ; ABCB7-006; intron 11
ENST00000529949 ; ABCB7-005; intron 11
ENST00000253577 ; ABCB7-001; intron 12
ENST00000373394 ; ABCB7-002; intron 12
Clustered miRNAs
< 10kb from hsa-mir-374a
hsa-mir-374achrX: 74287286-74287357 [-]
hsa-mir-545chrX: 74287104-74287209 [-]
Database links

Mature sequence hsa-miR-374a-5p

Accession MIMAT0000727
Previous IDshsa-miR-374;hsa-miR-374a
Sequence

12 - 

uuauaauacaaccugauaagug

 - 33

Get sequence
Deep sequencing419 reads, 42 experiments
Evidence experimental; cloned [1-4], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-374a-3p

Accession MIMAT0004688
Previous IDshsa-miR-374a*
Sequence

42 - 

cuuaucagauuguauuguaauu

 - 63

Get sequence
Deep sequencing2992 reads, 50 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).