Stem-loop sequence hsa-mir-374a

Accession MI0000782
Previous IDs hsa-mir-374
Symbol HGNC:MIR374A
Description Homo sapiens miR-374a stem-loop
Gene family MIPF0000288; mir-374
Stem-loop
     c   c            c           u 
uacau ggc auuauaauacaa cugauaagugu a
||||| ||| |||||||||||| |||||||||||  
augug cug uaauguuauguu gacuauucacg u
     u   u            a           a 
Get sequence
Deep sequencing
3447 reads, 36 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 73507121-73507192 [-]
sense
OTTHUMT00000057255 ; NCRNA00182-001; intron 1
OTTHUMT00000057256 ; NCRNA00182-002; intron 1
OTTHUMT00000057257 ; NCRNA00182-003; intron 1
OTTHUMT00000057258 ; NCRNA00182-004; intron 1
OTTHUMT00000057256 ; NCRNA00182-002; intron 1
OTTHUMT00000057255 ; NCRNA00182-001; intron 1
OTTHUMT00000057257 ; NCRNA00182-003; intron 1
OTTHUMT00000057258 ; NCRNA00182-004; intron 1
OTTHUMT00000057256 ; FTX-002; intron 1
OTTHUMT00000057255 ; FTX-001; intron 1
OTTHUMT00000057257 ; FTX-003; intron 1
OTTHUMT00000057258 ; FTX-004; intron 1
ENST00000429124 ; FTX-001; intron 1
ENST00000430772 ; FTX-002; intron 1
ENST00000418855 ; FTX-003; intron 1
ENST00000455395 ; FTX-004; intron 1
ENST00000430772 ; FTX-002; intron 1
ENST00000429124 ; FTX-001; intron 1
ENST00000418855 ; FTX-003; intron 1
ENST00000455395 ; FTX-004; intron 1
ENST00000430772 ; FTX-002; intron 1
ENST00000429124 ; FTX-001; intron 1
ENST00000418855 ; FTX-003; intron 1
ENST00000455395 ; FTX-004; intron 1
Clustered miRNAs
< 10kb from hsa-mir-374a
hsa-mir-374a chrX: 73507121-73507192 [-]
hsa-mir-545 chrX: 73506939-73507044 [-]
Database links

Mature sequence hsa-miR-374a-5p

Accession MIMAT0000727
Previous IDs hsa-miR-374;hsa-miR-374a
Sequence

12 - 

uuauaauacaaccugauaagug

 - 33

Get sequence
Deep sequencing 2083 reads, 35 experiments
Evidence experimental; cloned [1-4], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-374a-3p

Accession MIMAT0004688
Previous IDs hsa-miR-374a*
Sequence

42 - 

cuuaucagauuguauuguaauu

 - 63

Get sequence
Deep sequencing 1363 reads, 16 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).