|
miRBase |
|
Stem-loop sequence hsa-mir-374a |
||||||
| Accession | MI0000782 | |||||
| Previous IDs | hsa-mir-374 | |||||
| Symbol | HGNC:MIR374A | |||||
| Description | Homo sapiens miR-374a stem-loop | |||||
| Gene family | MIPF0000288; mir-374 | |||||
| Stem-loop |
c c c u uacau ggc auuauaauacaa cugauaagugu a ||||| ||| |||||||||||| ||||||||||| augug cug uaauguuauguu gacuauucacg u u u a a |
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
Mature sequence hsa-miR-374a-5p |
|
| Accession | MIMAT0000727 |
| Previous IDs | hsa-miR-374;hsa-miR-374a |
| Sequence |
12 - uuauaauacaaccugauaagug - 33 |
| Deep sequencing | 2083 reads, 35 experiments |
| Evidence | experimental; cloned [1-4], Northern [1] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-374a-3p |
|
| Accession | MIMAT0004688 |
| Previous IDs | hsa-miR-374a* |
| Sequence |
42 - cuuaucagauuguauuguaauu - 63 |
| Deep sequencing | 1363 reads, 16 experiments |
| Evidence | experimental; cloned [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|