Stem-loop sequence hsa-mir-373

AccessionMI0000781
Symbol HGNC:MIR373
DescriptionHomo sapiens miR-373 stem-loop
Gene family MIPF0000500; mir-373
Stem-loop
            -     g            uuuuug 
5' gggauacuc aaaau ggggcgcuuucc      u
   ||||||||| ||||| ||||||||||||       
3' cccuguggg uuuua cuucgugaaggg      c
            g     g            ucaugu 
Get sequence
Deep sequencing
107 reads, 79 reads per million, 16 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 53788705-53788773 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-373
hsa-mir-371achr19: 53787675-53787741 [+]
hsa-mir-371bchr19: 53787677-53787742 [-]
hsa-mir-372chr19: 53787890-53787956 [+]
hsa-mir-373chr19: 53788705-53788773 [+]
Database links

Mature sequence hsa-miR-373-5p

Accession MIMAT0000725
Previous IDshsa-miR-373*
Sequence

6 - 

acucaaaaugggggcgcuuucc

 - 27

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence hsa-miR-373-3p

Accession MIMAT0000726
Previous IDshsa-miR-373
Sequence

44 - 

gaagugcuucgauuuuggggugu

 - 66

Get sequence
Deep sequencing12 reads, 5 experiments
Evidence experimental; cloned [1-2], Northern [1]
Validated targets
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).