Stem-loop sequence hsa-mir-371a

AccessionMI0000779
Previous IDshsa-mir-371
Symbol HGNC:MIR371
DescriptionHomo sapiens miR-371a stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
               cu    g         u   c 
5' guggcacucaaa  gugg ggcacuuuc gcu u
   ||||||||||||  |||| ||||||||| |||  
3' cauugugaguuu  uacc ccgugaaag ugg c
               uc    g         -   u 
Get sequence
Deep sequencing
52 reads, 56.4 reads per million, 18 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Human miR-371 (MI0000779), miR-372 (MI0000780) and miR-373 (MI0000781) are clustered within 1.1kb on chromosome 19. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 53787675-53787741 [+]
sense
OTTHUMT00000464289 ; FAM90A27P-001; exon 4
ENST00000593323 ; FAM90A27P-001; exon 4
ENST00000338885 ; FAM90A27P-201; exon 4
Clustered miRNAs
< 10kb from hsa-mir-371a
hsa-mir-371achr19: 53787675-53787741 [+]
hsa-mir-371bchr19: 53787677-53787742 [-]
hsa-mir-372chr19: 53787890-53787956 [+]
hsa-mir-373chr19: 53788705-53788773 [+]
Database links

Mature sequence hsa-miR-371a-5p

Accession MIMAT0004687
Previous IDshsa-miR-371-5p
Sequence

6 - 

acucaaacugugggggcacu

 - 25

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-371a-3p

Accession MIMAT0000723
Previous IDshsa-miR-371;hsa-miR-371-3p
Sequence

42 - 

aagugccgccaucuuuugagugu

 - 64

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; cloned [1-2], Northern [1]
Validated targets
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).