Stem-loop sequence hsa-mir-371a

Accession

MI0000779

Previous IDs

hsa-mir-371

Symbol

HGNC:MIR371

Description

Homo sapiens miR-371a stem-loop

Gene family

MIPF0000068; mir-290

Stem-loop

            cu    g         u   c 
guggcacucaaa  gugg ggcacuuuc gcu u
||||||||||||  |||| ||||||||| |||  
cauugugaguuu  uacc ccgugaaag ugg c
            uc    g         -   u 

Deep sequencing

14 reads, 6 experiments

Comments

Human miR-371 (MI0000779 ), miR-372 (MI0000780 ) and miR-373 (MI0000781 ) are clustered within 1.1kb on chromosome 19. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh37.p5): chr19: 54290929-54290995 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-371a

• hsa-mir-371a: chr19: 54290929-54290995 [+]
• hsa-mir-371b: chr19: 54290931-54290996 [-]
• hsa-mir-372: chr19: 54291144-54291210 [+]
• hsa-mir-373: chr19: 54291959-54292027 [+]

Database links

• ENTREZGENE: 442916;MIR371
• HGNC: 31785;MIR371

Mature sequence hsa-miR-371a-5p

• Accession: MIMAT0004687
• Previous IDs: hsa-miR-371-5p
• Sequence: 6 - acucaaacugugggggcacu - 25
• Deep sequencing: 10 reads, 4 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-371a-5p
  • MICRORNA.ORG:hsa-miR-371a-5p
  • MIRDB:hsa-miR-371a-5p
  • RNA22-HSA:hsa-miR-371a-5p
  • TARGETMINER:hsa-miR-371a-5p
  • TARGETSCAN-VERT:hsa-miR-371-5p
  • PICTAR-VERT:hsa-miR-371

Mature sequence hsa-miR-371a-3p

• Accession: MIMAT0000723
• Previous IDs: hsa-miR-371;hsa-miR-371-3p
• Sequence: 42 - aagugccgccaucuuuugagugu - 64
• Deep sequencing: 2 reads, 1 experiments
• Evidence: experimental; cloned [1-2], Northern [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-371a-3p
  • MICRORNA.ORG:hsa-miR-371a-3p
  • MIRDB:hsa-miR-371a-3p
  • RNA22-HSA:hsa-miR-371a-3p
  • TARGETMINER:hsa-miR-371a-3p
  • TARGETSCAN-VERT:hsa-miR-371-3p
  • PICTAR-VERT:hsa-miR-371

References

1. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).