Stem-loop sequence hsa-mir-370

AccessionMI0000778
Symbol HGNC:MIR370
DescriptionHomo sapiens miR-370 stem-loop
Gene family MIPF0000167; mir-370
Stem-loop
         agaa       ca gu   u    u   a ag 
5' agacag    gccaggu  c  cuc gcag uac c  c
   ||||||    |||||||  |  ||| |||| ||| |  u
3' ucuguc    uggucca  g  ggg cguc gug g  c
         ----       ag ug   u    c   a ca 
Get sequence
Deep sequencing
10160 reads, 179 reads per million, 22 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 100911139-100911213 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Database links

Mature sequence hsa-miR-370-5p

Accession MIMAT0026483
Sequence

13 - 

caggucacgucucugcaguuac

 - 34

Get sequence
Deep sequencing14 reads, 3 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence hsa-miR-370-3p

Accession MIMAT0000722
Sequence

48 - 

gccugcugggguggaaccuggu

 - 69

Get sequence
Deep sequencing34 reads, 9 experiments
Evidence experimental; cloned [1-3], Illumina [4]
Validated targets
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).