Stem-loop sequence hsa-mir-370

Accession MI0000778
Symbol HGNC:MIR370
Description Homo sapiens miR-370 stem-loop
Gene family MIPF0000167; mir-370
Stem-loop 
      agaa       ca gu   u    u   a ag 
agacag    gccaggu  c  cuc gcag uac c  c
||||||    |||||||  |  ||| |||| ||| |  u
ucuguc    uggucca  g  ggg cguc gug g  c
      ----       ag ug   u    c   a ca
Get sequence
Deep sequencing
79 reads, 4 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 101377476-101377550 [+]
sense
OTTHUMT00000414503 ; RP11-909M7.1-005; intron 2
OTTHUMT00000414503 ; RP11-909M7.1-005; intron 2
OTTHUMT00000414503 ; RP11-909M7.1-005; intron 2
OTTHUMT00000414501 ; RP11-909M7.1-001; intron 5
OTTHUMT00000414501 ; RP11-909M7.1-001; intron 5
OTTHUMT00000414501 ; RP11-909M7.1-001; intron 5
ENST00000556475 ; RP11-909M7.1-005; intron 2
ENST00000556475 ; MEG8-005; intron 2
ENST00000556475 ; MEG8-005; intron 2
ENST00000553465 ; RP11-909M7.1-001; intron 5
ENST00000553465 ; MEG8-001; intron 5
ENST00000553465 ; MEG8-001; intron 5
Database links

Mature sequence hsa-miR-370

Accession MIMAT0000722
Sequence

48 -  

gccugcugggguggaaccuggu

 - 69

Get sequence
Deep sequencing 67 reads, 4 experiments
Evidence experimental; cloned [1-3]
Validated targets
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).