Stem-loop sequence hsa-mir-369

AccessionMI0000777 (change log)
Symbol HGNC:MIR369
DescriptionHomo sapiens miR-369 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u   ag               ua      cuuua 
5'  uga  ggagaucgaccgugu  uauucg     u
    |||  |||||||||||||||  ||||||      
3'  acu  uuucuaguugguaca  auaagc     u
   g   cu               ua      uucag 
Get sequence
Deep sequencing
5257 reads, 150 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101065598-101065667 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-369
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-369-5p

Accession MIMAT0001621
Sequence

9 - 

agaucgaccguguuauauucgc

 - 30

Get sequence
Deep sequencing290 reads, 25 experiments
Evidence experimental; cloned [2-4]
Database links
Predicted targets

Mature sequence hsa-miR-369-3p

Accession MIMAT0000721
Previous IDshsa-miR-369
Sequence

44 - 

aauaauacaugguugaucuuu

 - 64

Get sequence
Deep sequencing4967 reads, 43 experiments
Evidence experimental; cloned [1-4]
Database links
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).