Stem-loop sequence hsa-mir-367

AccessionMI0000775
Symbol HGNC:MIR367
DescriptionHomo sapiens miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
                   ua     c    uugaa 
5' ccauuacuguugcuaa  ugcaa ucug     u
   ||||||||||||||||  ||||| ||||      
3' gguagugguaacgauu  acguu aggu     a
                   uc     a    uaaau 
Get sequence
Deep sequencing
10 reads, 140 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr4: 112647874-112647941 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-367
hsa-mir-302bchr4: 112648485-112648557 [-]
hsa-mir-302cchr4: 112648363-112648430 [-]
hsa-mir-302achr4: 112648183-112648251 [-]
hsa-mir-302dchr4: 112648004-112648071 [-]
hsa-mir-367chr4: 112647874-112647941 [-]
Database links

Mature sequence hsa-miR-367-5p

Accession MIMAT0004686
Previous IDshsa-miR-367*
Sequence

6 - 

acuguugcuaauaugcaacucu

 - 27

Get sequence
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-367-3p

Accession MIMAT0000719
Previous IDshsa-miR-367
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; cloned [1-3], Northern [1]
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).