Stem-loop sequence hsa-mir-367

Accession MI0000775
Symbol HGNC:MIR367
Description Homo sapiens miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop 
                ua     c    uugaa 
ccauuacuguugcuaa  ugcaa ucug     u
||||||||||||||||  ||||| ||||      
gguagugguaacgauu  acguu aggu     a
                uc     a    uaaau
Get sequence
Deep sequencing
6 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 113569030-113569097 [-]
sense
OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1
OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1
OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1
OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1
OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1
OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1
OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2
OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2
OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2
ENST00000509938 ; RP11-148B6.1-001; intron 1
ENST00000505215 ; RP11-148B6.1-003; intron 1
ENST00000509938 ; RP11-148B6.1-001; intron 1
ENST00000505215 ; RP11-148B6.1-003; intron 1
ENST00000509938 ; RP11-148B6.1-001; intron 1
ENST00000505215 ; RP11-148B6.1-003; intron 1
ENST00000510655 ; RP11-148B6.1-002; intron 2
ENST00000510655 ; RP11-148B6.1-002; intron 2
ENST00000510655 ; RP11-148B6.1-002; intron 2
antisense
OTTHUMT00000365309 ; LARP7-013; intron 2
OTTHUMT00000365309 ; LARP7-013; intron 2
OTTHUMT00000365309 ; LARP7-013; intron 2
OTTHUMT00000365307 ; LARP7-011; intron 3
OTTHUMT00000365307 ; LARP7-011; intron 3
OTTHUMT00000365307 ; LARP7-011; intron 3
OTTHUMT00000256417 ; LARP7-001; intron 8
OTTHUMT00000363892 ; LARP7-003; intron 8
OTTHUMT00000256417 ; LARP7-001; intron 8
OTTHUMT00000363892 ; LARP7-003; intron 8
OTTHUMT00000256417 ; LARP7-001; intron 8
OTTHUMT00000363892 ; LARP7-003; intron 8
OTTHUMT00000363891 ; LARP7-002; intron 10
OTTHUMT00000363891 ; LARP7-002; intron 10
OTTHUMT00000363891 ; LARP7-002; intron 10
ENST00000511529 ; LARP7-013; intron 2
ENST00000511529 ; LARP7-013; intron 2
ENST00000511529 ; LARP7-013; intron 2
ENST00000513553 ; LARP7-011; intron 3
ENST00000513553 ; LARP7-011; intron 3
ENST00000513553 ; LARP7-011; intron 3
ENST00000344442 ; LARP7-001; intron 8
ENST00000509622 ; LARP7-003; intron 8
ENST00000324052 ; LARP7-201; intron 8
ENST00000344442 ; LARP7-001; intron 8
ENST00000509622 ; LARP7-003; intron 8
ENST00000324052 ; LARP7-201; intron 8
ENST00000344442 ; LARP7-001; intron 8
ENST00000509622 ; LARP7-003; intron 8
ENST00000324052 ; LARP7-201; intron 8
ENST00000509061 ; LARP7-002; intron 10
ENST00000509061 ; LARP7-002; intron 10
ENST00000509061 ; LARP7-002; intron 10
Clustered miRNAs
< 10kb from hsa-mir-367
hsa-mir-302b chr4: 113569641-113569713 [-]
hsa-mir-302c chr4: 113569519-113569586 [-]
hsa-mir-302a chr4: 113569339-113569407 [-]
hsa-mir-302d chr4: 113569160-113569227 [-]
hsa-mir-367 chr4: 113569030-113569097 [-]
Database links

Mature sequence hsa-miR-367-5p

Accession MIMAT0004686
Previous IDs hsa-miR-367*
Sequence

6 -  

acuguugcuaauaugcaacucu

 - 27

Get sequence
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-367-3p

Accession MIMAT0000719
Previous IDs hsa-miR-367
Sequence

44 -  

aauugcacuuuagcaaugguga

 - 65

Get sequence
Deep sequencing 6 reads, 2 experiments
Evidence experimental; cloned [1-3], Northern [1]
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).