Stem-loop sequence hsa-mir-302d

AccessionMI0000774
Symbol HGNC:MIR302D
DescriptionHomo sapiens miR-302d stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
     u u    u                ---c   ga 
5' cc c acuu aacauggaggcacuug    ugu  c
   || | |||| ||||||||||||||||    |||   
3' gg g ugag uuguaccuucgugaau    aca  a
     u -    u                aaaa   gu 
Get sequence
Deep sequencing
57163 reads, 6.57e+04 reads per million, 11 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Human miR-302a (MI0000738), miR-302b (MI0000772), miR-302c (MI0000773), miR-302d (MI0000774) and miR-367 (MI0000775) are clustered on chromosome 4.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr4: 112648004-112648071 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-302d
hsa-mir-302bchr4: 112648485-112648557 [-]
hsa-mir-302cchr4: 112648363-112648430 [-]
hsa-mir-302achr4: 112648183-112648251 [-]
hsa-mir-302dchr4: 112648004-112648071 [-]
hsa-mir-367chr4: 112647874-112647941 [-]
Database links

Mature sequence hsa-miR-302d-5p

Accession MIMAT0004685
Previous IDshsa-miR-302d*
Sequence

6 - 

acuuuaacauggaggcacuugc

 - 27

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-302d-3p

Accession MIMAT0000718
Previous IDshsa-miR-302d
Sequence

44 - 

uaagugcuuccauguuugagugu

 - 66

Get sequence
Deep sequencing37737 reads, 4 experiments
Evidence experimental; cloned [1-2], Northern [1]
Validated targets
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).