Stem-loop sequence hsa-mir-302b

AccessionMI0000772
Symbol HGNC:MIR302B
DescriptionHomo sapiens miR-302b stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
        cuuca   uu          ug   u  guga 
5' gcucc     acu  aacauggaag  cuu cu    c
   |||||     |||  ||||||||||  ||| ||    u
3' ugagg     uga  uuguaccuuc  gaa ga    u
        ----a   uu          gu   u  aaau 
Get sequence
Deep sequencing
49672 reads, 4.58e+04 reads per million, 13 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr4: 112648485-112648557 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-302b
hsa-mir-302bchr4: 112648485-112648557 [-]
hsa-mir-302cchr4: 112648363-112648430 [-]
hsa-mir-302achr4: 112648183-112648251 [-]
hsa-mir-302dchr4: 112648004-112648071 [-]
hsa-mir-367chr4: 112647874-112647941 [-]
Database links

Mature sequence hsa-miR-302b-5p

Accession MIMAT0000714
Previous IDshsa-miR-302b*
Sequence

11 - 

acuuuaacauggaagugcuuuc

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1-2], Northern [1]
Predicted targets

Mature sequence hsa-miR-302b-3p

Accession MIMAT0000715
Previous IDshsa-miR-302b
Sequence

47 - 

uaagugcuuccauguuuuaguag

 - 69

Get sequence
Deep sequencing33903 reads, 5 experiments
Evidence experimental; cloned [1-2], Northern [1]
Validated targets
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).