Stem-loop sequence hsa-mir-365b

AccessionMI0000769 (change log)
Previous IDshsa-mir-365-2
Symbol HGNC:MIR365B
DescriptionHomo sapiens miR-365b stem-loop
Gene family MIPF0000061; mir-365
Literature search

61 open access papers mention hsa-mir-365b
(315 sentences)

Stem-loop
   agaguguucaa g   --       a        ac   c       -----    u   u 
5'            g aca  gcaagaa aaugaggg  uuu aggggca     gcug guu u
              | |||  ||||||| ||||||||  ||| |||||||     |||| |||  
3'            c ugu  cguucuu uuauuccu  aaa uccccgu     ugac cag c
   -----gggcua g   ga       g        aa   -       aauac    u   u 
Get sequence
Deep sequencing
230531 reads, 1.03e+03 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MI0000486).

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 31575411-31575521 [+]
antisense
OTTHUMT00000256378 ; ASIC2-001; intron 1
OTTHUMT00000447552 ; ASIC2-003; intron 1
OTTHUMT00000447553 ; ASIC2-004; intron 1
OTTHUMT00000256379 ; ASIC2-002; intron 2
ENST00000225823 ; ASIC2-001; intron 1
ENST00000359872 ; ASIC2-003; intron 1
ENST00000579816 ; ASIC2-004; intron 1
ENST00000448983 ; ASIC2-002; intron 2
Clustered miRNAs
< 10kb from hsa-mir-365b
hsa-mir-4725chr17: 31575269-31575358 [+]
hsa-mir-365bchr17: 31575411-31575521 [+]
Database links

Mature sequence hsa-miR-365b-5p

Accession MIMAT0022833
Sequence

29 - 

agggacuuucaggggcagcugu

 - 50

Get sequence
Deep sequencing7975 reads, 110 experiments
Evidence experimental; 454 [5]
Database links
Predicted targets

Mature sequence hsa-miR-365b-3p

Accession MIMAT0022834
Sequence

68 - 

uaaugccccuaaaaauccuuau

 - 89

Get sequence
Deep sequencing222462 reads, 159 experiments
Evidence experimental; cloned [1,3-4], array-cloned [2]
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).