Stem-loop sequence hsa-mir-365b

Accession

MI0000769

Previous IDs

hsa-mir-365-2

Symbol

HGNC:MIR365-2

Description

Homo sapiens miR-365b stem-loop

Gene family

MIPF0000061; mir-365

Stem-loop

agaguguucaa g   --       a        ac   c       -----    u   u 
           g aca  gcaagaa aaugaggg  uuu aggggca     gcug guu u
           | |||  ||||||| ||||||||  ||| |||||||     |||| |||  
           c ugu  cguucuu uuauuccu  aaa uccccgu     ugac cag c
-----gggcua g   ga       g        aa   -       aauac    u   u 

Deep sequencing

9634 reads, 28 experiments

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MI0000486 ).

Genome context

• Coordinates (GRCh37.p5): chr17: 29902430-29902540 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000256194 ; AC003101.1-001; intron 2

  OTTHUMT00000256194 ; AC003101.1-001; 3'UTR (exon 3)

  OTTHUMT00000256194 ; AC003101.1-001; 3'UTR (exon 3)

  ENST00000412403 ; AC003101.1-001; intron 2

  ENST00000412403 ; AC003101.1-001; 3'UTR (exon 3)

  ENST00000412403 ; AC003101.1-001; 3'UTR (exon 3)

Clustered miRNAs

< 10kb from hsa-mir-365b

• hsa-mir-4725: chr17: 29902288-29902377 [+]
• hsa-mir-365b: chr17: 29902430-29902540 [+]

Database links

• EMBL: AY882279;AY882279
• ENTREZGENE: 100126356;MIR365-2
• HGNC: 33693;MIR365-2

Mature sequence hsa-miR-365b-5p

• Accession: MIMAT0022833
• Sequence: 29 - agggacuuucaggggcagcugu - 50
• Deep sequencing: 2949 reads, 17 experiments
• Evidence: experimental; 454 [6]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-365b-5p
  • MIRDB:hsa-miR-365b-5p
  • TARGETMINER:hsa-miR-365b-5p

Mature sequence hsa-miR-365b-3p

• Accession: MIMAT0022834
• Sequence: 68 - uaaugccccuaaaaauccuuau - 89
• Deep sequencing: 6677 reads, 25 experiments
• Evidence: experimental; cloned [1,3-4], array-cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-365b-3p
  • MIRDB:hsa-miR-365b-3p
  • TARGETMINER:hsa-miR-365b-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5. PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).