Stem-loop sequence mmu-mir-365-1

AccessionMI0000768 (change log)
Symbol MGI:Mir365-1
DescriptionMus musculus miR-365-1 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   acc      aa        ac           ga    uuucca 
5'    gcaggg  aaugaggg  uuuugggggca  ugug      u
      ||||||  ||||||||  |||||||||||  ||||      u
3'    cguucu  uuauuccu  aaaauccccgu  auac      c
   --a      cg        -a           -a    uaucgc 
Get sequence
Deep sequencing
10373 reads, 40 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MI0000321).

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 13453840-13453926 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-365-1
mmu-mir-193bchr16: 13449523-13449601 [+]
mmu-mir-365-1chr16: 13453840-13453926 [+]
Database links

Mature sequence mmu-miR-365-1-5p

Accession MIMAT0017077
Previous IDsmmu-miR-365-1*
Sequence

16 - 

agggacuuuugggggcagaugug

 - 38

Get sequence
Deep sequencing572 reads, 38 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-365-3p

Accession MIMAT0000711
Previous IDsmmu-miR-365
Sequence

56 - 

uaaugccccuaaaaauccuuau

 - 77

Get sequence
Deep sequencing19603 reads, 75 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).