Stem-loop sequence mmu-mir-363

AccessionMI0000765 (change log)
Symbol MGI:Mir363
DescriptionMus musculus miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   u   au        -  a  a         gg  ggug 
5'  guu  caggugga ac cg ugcaauuuu  uu    u
    |||  |||||||| || || |||||||||  ||     
3'  caa  gucuaccu ug gc acguuaaaa  ag    a
   c   au        a  -  -         gg  gaua 
Get sequence
Deep sequencing
110293 reads, 348 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 52741693-52741767 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-363
mmu-mir-106achrX: 52742503-52742567 [-]
mmu-mir-18bchrX: 52742331-52742413 [-]
mmu-mir-20bchrX: 52742113-52742192 [-]
mmu-mir-19b-2chrX: 52741983-52742066 [-]
mmu-mir-92a-2chrX: 52741838-52741928 [-]
mmu-mir-363chrX: 52741693-52741767 [-]
Database links

Mature sequence mmu-miR-363-5p

Accession MIMAT0017076
Sequence

7 - 

cagguggaacacgaugcaauuu

 - 28

Get sequence
Deep sequencing62241 reads, 61 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-363-3p

Accession MIMAT0000708
Previous IDsmmu-miR-363
Sequence

50 - 

aauugcacgguauccaucugua

 - 71

Get sequence
Deep sequencing47923 reads, 72 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).