|
miRBase |
|
Stem-loop sequence hsa-mir-363 |
|||||
| Accession | MI0000764 | ||||
| Symbol | HGNC:MIR363 | ||||
| Description | Homo sapiens miR-363 stem-loop | ||||
| Gene family | MIPF0000138; mir-363 | ||||
| Stem-loop |
u gu ca a -----g a guu cggguggau cg ugcaauuuu aug g ||| ||||||||| || ||||||||| ||| u caa gucuaccua gc acguuaaaa uac a c au ug - agagga u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-363-5p |
|
| Accession | MIMAT0003385 |
| Previous IDs | hsa-miR-363* |
| Sequence |
7 - cggguggaucacgaugcaauuu - 28 |
| Deep sequencing | 1733 reads, 10 experiments |
| Evidence | experimental; cloned [2-3] |
| Predicted targets |
|
Mature sequence hsa-miR-363-3p |
|
| Accession | MIMAT0000707 |
| Previous IDs | hsa-miR-363 |
| Sequence |
50 - aauugcacgguauccaucugua - 71 |
| Deep sequencing | 34144 reads, 22 experiments |
| Evidence | experimental; array-cloned [1], cloned [2-3] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|