Stem-loop sequence hsa-mir-363

AccessionMI0000764
Symbol HGNC:MIR363
DescriptionHomo sapiens miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
u   gu         ca  a         -----g   a 
 guu  cggguggau  cg ugcaauuuu      aug g
 |||  |||||||||  || |||||||||      ||| u
 caa  gucuaccua  gc acguuaaaa      uac a
c   au         ug  -         agagga   u 
Get sequence
Deep sequencing
67563 reads, 4.72e+03 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 134169378-134169452 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-363
hsa-mir-106achrX: 134170198-134170278 [-]
hsa-mir-18bchrX: 134170041-134170111 [-]
hsa-mir-20bchrX: 134169809-134169877 [-]
hsa-mir-19b-2chrX: 134169671-134169766 [-]
hsa-mir-92a-2chrX: 134169538-134169612 [-]
hsa-mir-363chrX: 134169378-134169452 [-]
Database links

Mature sequence hsa-miR-363-5p

Accession MIMAT0003385
Previous IDshsa-miR-363*
Sequence

7 - 

cggguggaucacgaugcaauuu

 - 28

Get sequence
Deep sequencing2589 reads, 17 experiments
Evidence experimental; cloned [2-3]
Predicted targets

Mature sequence hsa-miR-363-3p

Accession MIMAT0000707
Previous IDshsa-miR-363
Sequence

50 - 

aauugcacgguauccaucugua

 - 71

Get sequence
Deep sequencing44868 reads, 51 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).