Stem-loop sequence mmu-mir-362

AccessionMI0000763 (change log)
Symbol MGI:Mir362
DescriptionMus musculus miR-362 stem-loop
Gene family MIPF0000209; mir-362
Stem-loop
   cuc           acc        aa   u  u 
5'    gaauccuugga   uaggugug  ugc gc u
      |||||||||||   ||||||||  ||| ||  
3'    cuuaggaacuu   guccacac  acg ug c
   aaa           ---        -a   -  a 
Get sequence
Deep sequencing
33783 reads, 72 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 7241982-7242046 [-]
sense
OTTMUST00000039775 ; Clcn5-003; intron 2
OTTMUST00000039776 ; Clcn5-004; intron 3
OTTMUST00000039777 ; Clcn5-005; intron 3
ENSMUST00000128319 ; Clcn5-003; intron 2
ENSMUST00000115746 ; Clcn5-004; intron 3
ENSMUST00000132126 ; Clcn5-005; intron 3
Clustered miRNAs
< 10kb from mmu-mir-362
mmu-mir-532chrX: 7248402-7248497 [-]
mmu-mir-188chrX: 7247989-7248056 [-]
mmu-mir-362chrX: 7241982-7242046 [-]
mmu-mir-501chrX: 7241243-7241351 [-]
mmu-mir-500chrX: 7237683-7237774 [-]
Database links

Mature sequence mmu-miR-362-5p

Accession MIMAT0000706
Previous IDsmmu-miR-362
Sequence

5 - 

aauccuuggaaccuaggugugaau

 - 28

Get sequence
Deep sequencing15413 reads, 75 experiments
Evidence experimental; cloned [1,3], MPSS [2], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-362-3p

Accession MIMAT0004684
Sequence

42 - 

aacacaccuguucaaggauuca

 - 63

Get sequence
Deep sequencing18370 reads, 75 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).