|
miRBase |
|
Stem-loop sequence hsa-mir-362 |
|||||
| Accession | MI0000762 | ||||
| Symbol | HGNC:MIR362 | ||||
| Description | Homo sapiens miR-362 stem-loop | ||||
| Gene family | MIPF0000209; mir-362 | ||||
| Stem-loop |
c acc -a ug a uugaauccuugga uaggugug g cu u ||||||||||||| |||||||| | || u aacuuaggaacuu auccacac c ga u a --- aa gu c |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-362-5p |
|
| Accession | MIMAT0000705 |
| Previous IDs | hsa-miR-362 |
| Sequence |
5 - aauccuuggaaccuaggugugagu - 28 |
| Deep sequencing | 781 reads, 26 experiments |
| Evidence | experimental; array-cloned [1], cloned [2-3] |
| Predicted targets |
|
Mature sequence hsa-miR-362-3p |
|
| Accession | MIMAT0004683 |
| Sequence |
42 - aacacaccuauucaaggauuca - 63 |
| Deep sequencing | 644 reads, 22 experiments |
| Evidence | experimental; cloned [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|