Stem-loop sequence mmu-mir-361

AccessionMI0000761 (change log)
Symbol MGI:Mir361
DescriptionMus musculus miR-361 stem-loop
Gene family MIPF0000172; mir-361
Stem-loop
        uu         --u  a    u    agua 
5' gaagc  aucagaauc   cc gggg acuu    u
   |||||  |||||||||   || |||| ||||     
3' cuuug  uagucuuag   gg cccc ugaa    u
        uu         ugu  a    c    aagu 
Get sequence
Deep sequencing
35821 reads, 155 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 113074824-113074893 [-]
sense
OTTMUST00000044723 ; Chm-002; intron 8
OTTMUST00000044722 ; Chm-001; intron 9
OTTMUST00000044724 ; Chm-003; intron 9
ENSMUST00000113388 ; Chm-002; intron 8
ENSMUST00000026607 ; Chm-001; intron 9
ENSMUST00000135821 ; Chm-003; intron 9
Database links

Mature sequence mmu-miR-361-5p

Accession MIMAT0000704
Previous IDsmmu-miR-361
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing31004 reads, 76 experiments
Evidence experimental; cloned [1-2], Illumina [3,5]
Database links
Predicted targets

Mature sequence mmu-miR-361-3p

Accession MIMAT0017075
Previous IDsmmu-miR-361*
Sequence

43 - 

ucccccaggugugauucugauuugu

 - 67

Get sequence
Deep sequencing4817 reads, 75 experiments
Evidence experimental; 454 [4], Illumina [5]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).