Stem-loop sequence hsa-mir-361

AccessionMI0000760 (change log)
Symbol HGNC:MIR361
DescriptionHomo sapiens miR-361 stem-loop
Gene family MIPF0000172; mir-361
Literature search

63 open access papers mention hsa-mir-361
(420 sentences)

Stem-loop
        uu         --u  a    u     auaa 
5' ggagc  aucagaauc   cc gggg acuuu    u
   |||||  |||||||||   || |||| |||||     
3' cuucg  uagucuuag   gg cccc ugaaa    u
        uu         ugu  a    c     aacu 
Get sequence
Deep sequencing
427728 reads, 867 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 85903636-85903707 [-]
antisense
OTTHUMT00000057407 ; DACH2-001; intron 2
OTTHUMT00000057408 ; DACH2-002; intron 2
OTTHUMT00000057409 ; DACH2-003; intron 3
OTTHUMT00000359267 ; DACH2-008; intron 3
OTTHUMT00000359266 ; DACH2-007; intron 3
OTTHUMT00000359265 ; DACH2-006; intron 3
ENST00000373131 ; DACH2-001; intron 2
ENST00000510272 ; DACH2-002; intron 2
ENST00000461604 ; DACH2-003; intron 3
ENST00000506327 ; DACH2-008; intron 3
ENST00000373125 ; DACH2-007; intron 3
ENST00000508860 ; DACH2-006; intron 3
Database links

Mature sequence hsa-miR-361-5p

Accession MIMAT0000703
Previous IDshsa-miR-361
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing377709 reads, 159 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-361-3p

Accession MIMAT0004682
Sequence

45 - 

ucccccaggugugauucugauuu

 - 67

Get sequence
Deep sequencing50009 reads, 156 experiments
Evidence experimental; cloned [2-3], Northern [3]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).