Stem-loop sequence hsa-mir-361

AccessionMI0000760 (change log)
Symbol HGNC:MIR361
DescriptionHomo sapiens miR-361 stem-loop
Gene family MIPF0000172; mir-361
Stem-loop
        uu         --u  a    u     auaa 
5' ggagc  aucagaauc   cc gggg acuuu    u
   |||||  |||||||||   || |||| |||||     
3' cuucg  uagucuuag   gg cccc ugaaa    u
        uu         ugu  a    c     aacu 
Get sequence
Deep sequencing
73549 reads, 731 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 85903636-85903707 [-]
antisense
OTTHUMT00000057407 ; DACH2-001; intron 2
OTTHUMT00000057408 ; DACH2-002; intron 2
OTTHUMT00000057409 ; DACH2-003; intron 3
OTTHUMT00000359267 ; DACH2-008; intron 3
OTTHUMT00000359266 ; DACH2-007; intron 3
OTTHUMT00000359265 ; DACH2-006; intron 3
ENST00000373131 ; DACH2-001; intron 2
ENST00000510272 ; DACH2-002; intron 2
ENST00000461604 ; DACH2-003; intron 3
ENST00000506327 ; DACH2-008; intron 3
ENST00000373125 ; DACH2-007; intron 3
ENST00000508860 ; DACH2-006; intron 3
Database links

Mature sequence hsa-miR-361-5p

Accession MIMAT0000703
Previous IDshsa-miR-361
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing60937 reads, 77 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-361-3p

Accession MIMAT0004682
Sequence

45 - 

ucccccaggugugauucugauuu

 - 67

Get sequence
Deep sequencing12611 reads, 74 experiments
Evidence experimental; cloned [2-3], Northern [3]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).