Stem-loop sequence cel-mir-355

Accession MI0000754
Description Caenorhabditis elegans miR-355 stem-loop
Gene family MIPF0000236; mir-355
Stem-loop 
-----aauaa      ---ga     a    u         -cu        ---ag  a 
          ugucaa     auuga uggu uguuuuagc   gagcuaug     uc u
          ||||||     ||||| |||| |||||||||   ||||||||     ||  
          gcaguu     uaacu accg acaaaaucg   uucgauac     ag c
aguuuuugaa      aauuc     a    u         uuc        guaua  g
Get sequence
Deep sequencing
17 reads, 4 experiments
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The 5' end of the mature sequence was mapped by PCR, and the 3' end confirmed later [2].

Genome context
Coordinates (WBcel215) Overlapping transcripts
II: 11833473-11833582 [-]
intergenic

Mature sequence cel-miR-355

Accession MIMAT0000697
Sequence

23 -  

uuuguuuuagccugagcuaug

 - 43

Get sequence
Deep sequencing 15 reads, 4 experiments
Evidence experimental; cloned [1-2], PCR [1], Solexa [3]
Validated targets
Predicted targets

References

1
PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).