Stem-loop sequence hsa-mir-30e

AccessionMI0000749 (change log)
Symbol HGNC:MIR30E
DescriptionHomo sapiens miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

357 open access papers mention hsa-mir-30e
(1645 sentences)

Stem-loop
   g        uu  ua            uu           g aag u 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   g g
    ||||||||  ||  ||||||||||||  ||||||||||| |   |  
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g   c u
   a        --  gc            --           g aga u 
Get sequence
Deep sequencing
7371458 reads, 1.07e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue of mouse miR-30e [1,2,4]. Mature products from both arms of the precursor (hsa-miR-30e-5p and hsa-miR-30e-3p) were later independently verified in human myelocytic leukemia (HL-60) cells [3]. Landgraf et al. later showed that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 40754355-40754446 [+]
sense
OTTHUMT00000015766 ; ZMPSTE24-001; intron 8
ENST00000372759 ; ZMPSTE24-001; intron 8
Clustered miRNAs
< 10kb from hsa-mir-30e
hsa-mir-30echr1: 40754355-40754446 [+]
hsa-mir-30c-1chr1: 40757284-40757372 [+]
Database links

Mature sequence hsa-miR-30e-5p

Accession MIMAT0000692
Previous IDshsa-miR-30e-5p;hsa-miR-30e
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Deep sequencing6647321 reads, 159 experiments
Evidence experimental; cloned [3,5-6]
Database links
Predicted targets

Mature sequence hsa-miR-30e-3p

Accession MIMAT0000693
Previous IDshsa-miR-30e-3p;hsa-miR-30e*
Sequence

59 - 

cuuucagucggauguuuacagc

 - 80

Get sequence
Deep sequencing723906 reads, 159 experiments
Evidence experimental; cloned [3,5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).