Stem-loop sequence hsa-mir-30e

AccessionMI0000749
Symbol HGNC:MIR30E
DescriptionHomo sapiens miR-30e stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g        uu  ua            uu           g aag u 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   g g
    ||||||||  ||  ||||||||||||  ||||||||||| |   |  
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g   c u
   a        --  gc            --           g aga u 
Get sequence
Deep sequencing
207818 reads, 8.1e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue of mouse miR-30e [1,2,4]. Mature products from both arms of the precursor (hsa-miR-30e-5p and hsa-miR-30e-3p) were later independently verified in human myelocytic leukemia (HL-60) cells [3]. Landgraf et al. later showed that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 40754355-40754446 [+]
sense
OTTHUMT00000015766 ; ZMPSTE24-001; intron 8
ENST00000372759 ; ZMPSTE24-001; intron 8
Clustered miRNAs
< 10kb from hsa-mir-30e
hsa-mir-30echr1: 40754355-40754446 [+]
hsa-mir-30c-1chr1: 40757284-40757372 [+]
Database links

Mature sequence hsa-miR-30e-5p

Accession MIMAT0000692
Previous IDshsa-miR-30e-5p;hsa-miR-30e
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Deep sequencing3436 reads, 68 experiments
Evidence experimental; cloned [3,5-6]
Validated targets
Predicted targets

Mature sequence hsa-miR-30e-3p

Accession MIMAT0000693
Previous IDshsa-miR-30e-3p;hsa-miR-30e*
Sequence

59 - 

cuuucagucggauguuuacagc

 - 80

Get sequence
Deep sequencing2164 reads, 56 experiments
Evidence experimental; cloned [3,5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).