Stem-loop sequence hsa-mir-130b

AccessionMI0000748 (change log)
Symbol HGNC:MIR130B
DescriptionHomo sapiens miR-130b stem-loop
Gene family MIPF0000034; mir-130
Literature search

176 open access papers mention hsa-mir-130b
(995 sentences)

Stem-loop
         c    ca       cc         a  --a   g 
5' ggccug ccga  cucuuuc  uguugcacu cu   uag c
   |||||| ||||  |||||||  ||||||||| ||   |||  
3' cuggac ggcu  gggaaag  guaacguga ga   guc c
         u    ac       ua         c  agg   g 
Get sequence
Deep sequencing
308134 reads, 869 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue of mouse miR-130b cloned from mouse embryonic stem cells [1,2]. Its expression was later verified in human BC-1 cells [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 21653304-21653385 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-130b
hsa-mir-301bchr22: 21652981-21653058 [+]
hsa-mir-130bchr22: 21653304-21653385 [+]
Database links

Mature sequence hsa-miR-130b-5p

Accession MIMAT0004680
Previous IDshsa-miR-130b*
Sequence

13 - 

acucuuucccuguugcacuac

 - 33

Get sequence
Deep sequencing14244 reads, 151 experiments
Evidence experimental; cloned [4-5]
Database links
Predicted targets

Mature sequence hsa-miR-130b-3p

Accession MIMAT0000691
Previous IDshsa-miR-130b
Sequence

51 - 

cagugcaaugaugaaagggcau

 - 72

Get sequence
Deep sequencing293876 reads, 158 experiments
Evidence experimental; cloned [3-5]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).