Stem-loop sequence hsa-mir-296

AccessionMI0000747
Symbol HGNC:MIR296
DescriptionHomo sapiens miR-296 stem-loop
Gene family MIPF0000159; mir-296
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-296. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-296 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-296 has been named an "angiomiR" due to being characterised as a microRNA which regulates angiogenesis, the process of growth and creation of new blood vessels. miR-296 is thought to have a specific role in cancer in promoting tumour angiogenesis. It achieves this by targeting HGS mRNA, reducing its expression in endothelial cells which then results in greater number of VEGF receptors. miR-296 has predicted target sites in the transcription factor NANOG and may also contribute to carcinogenesis by dysregulating p53.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ga      ca       c  c         g   ugc 
5' ag  cccuuc  gagggcc cc cucaauccu uug   c
   ||  ||||||  ||||||| || ||||||||| |||   u
3' uc  gggaag  cucucgg gg ggguuggga gac   a
     uc      uc       a  u         -   uua 
Get sequence
Deep sequencing
1633 reads, 355 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue of mouse miR-296 cloned from mouse embryonic stem cells [1,3]. Its expression has also been verified in human ES cells [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr20: 58817615-58817694 [-]
antisense
OTTHUMT00000079949 ; RP5-1043L13.1-003; intron 1
OTTHUMT00000079950 ; RP5-1043L13.1-004; intron 1
OTTHUMT00000079957 ; RP5-1043L13.1-011; intron 1
OTTHUMT00000079948 ; RP5-1043L13.1-002; intron 3
OTTHUMT00000079947 ; RP5-1043L13.1-001; intron 3
OTTHUMT00000079953 ; RP5-1043L13.1-007; intron 7
ENST00000437035 ; RP5-1043L13.1-003; intron 1
ENST00000421257 ; RP5-1043L13.1-004; intron 1
ENST00000427820 ; RP5-1043L13.1-011; intron 1
ENST00000458422 ; RP5-1043L13.1-002; intron 3
ENST00000432910 ; RP5-1043L13.1-001; intron 3
ENST00000431181 ; RP5-1043L13.1-007; intron 7
Clustered miRNAs
< 10kb from hsa-mir-296
hsa-mir-298chr20: 58818226-58818313 [-]
hsa-mir-296chr20: 58817615-58817694 [-]
Database links

Mature sequence hsa-miR-296-5p

Accession MIMAT0000690
Previous IDshsa-miR-296
Sequence

14 - 

agggcccccccucaauccugu

 - 34

Get sequence
Deep sequencing450 reads, 41 experiments
Evidence experimental; cloned [2,4-5]
Validated targets
Predicted targets

Mature sequence hsa-miR-296-3p

Accession MIMAT0004679
Sequence

48 - 

gaggguuggguggaggcucucc

 - 69

Get sequence
Deep sequencing251 reads, 35 experiments
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).