Stem-loop sequence hsa-mir-296

AccessionMI0000747 (change log)
Symbol HGNC:MIR296
DescriptionHomo sapiens miR-296 stem-loop
Gene family MIPF0000159; mir-296
Literature search

83 open access papers mention hsa-mir-296
(494 sentences)

Stem-loop
     ga      ca       c  c         g   ugc 
5' ag  cccuuc  gagggcc cc cucaauccu uug   c
   ||  ||||||  ||||||| || ||||||||| |||   u
3' uc  gggaag  cucucgg gg ggguuggga gac   a
     uc      uc       a  u         -   uua 
Get sequence
Deep sequencing
8961 reads, 12.3 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue of mouse miR-296 cloned from mouse embryonic stem cells [1,3]. Its expression has also been verified in human ES cells [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 58817615-58817694 [-]
antisense
OTTHUMT00000079949 ; RP5-1043L13.1-003; intron 1
OTTHUMT00000079950 ; RP5-1043L13.1-004; intron 1
OTTHUMT00000079957 ; RP5-1043L13.1-011; intron 1
OTTHUMT00000079948 ; RP5-1043L13.1-002; intron 3
OTTHUMT00000079947 ; RP5-1043L13.1-001; intron 3
OTTHUMT00000079953 ; RP5-1043L13.1-007; intron 7
ENST00000437035 ; RP5-1043L13.1-003; intron 1
ENST00000421257 ; RP5-1043L13.1-004; intron 1
ENST00000427820 ; RP5-1043L13.1-011; intron 1
ENST00000458422 ; RP5-1043L13.1-002; intron 3
ENST00000432910 ; RP5-1043L13.1-001; intron 3
ENST00000431181 ; RP5-1043L13.1-007; intron 7
Clustered miRNAs
< 10kb from hsa-mir-296
hsa-mir-298chr20: 58818226-58818313 [-]
hsa-mir-296chr20: 58817615-58817694 [-]
Database links

Mature sequence hsa-miR-296-5p

Accession MIMAT0000690
Previous IDshsa-miR-296
Sequence

14 - 

agggcccccccucaauccugu

 - 34

Get sequence
Deep sequencing4652 reads, 150 experiments
Evidence experimental; cloned [2,4-5]
Database links
Predicted targets

Mature sequence hsa-miR-296-3p

Accession MIMAT0004679
Sequence

48 - 

gaggguuggguggaggcucucc

 - 69

Get sequence
Deep sequencing4308 reads, 118 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).