Stem-loop sequence hsa-mir-99b

AccessionMI0000746
Symbol HGNC:MIR99B
DescriptionHomo sapiens miR-99b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        cc         ac   c    c - -   c 
5' ggcac  acccguaga  cga cuug g g ggc u
   |||||  |||||||||  ||| |||| | | |||  
3' cugug  ugggugucu  gcu gaac c c ccg u
        cc         gu   c    a a g   c 
Get sequence
Deep sequencing
17283 reads, 1.66e+03 reads per million, 70 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue of mouse miR-99b, cloned from mouse brain [1] and embryonic stem cells [2,3]. Its expression was later validated in human [4-6].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 51692612-51692681 [+]
sense
OTTHUMT00000465190 ; SIGLEC20P-001; intron 6
ENST00000595243 ; SIGLEC20P-001; intron 6
Clustered miRNAs
< 10kb from hsa-mir-99b
hsa-mir-99bchr19: 51692612-51692681 [+]
hsa-let-7echr19: 51692786-51692864 [+]
hsa-mir-125achr19: 51693254-51693339 [+]
Database links

Mature sequence hsa-miR-99b-5p

Accession MIMAT0000689
Previous IDshsa-miR-99b
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Deep sequencing1443 reads, 53 experiments
Evidence experimental; cloned [4-6]
Validated targets
Predicted targets

Mature sequence hsa-miR-99b-3p

Accession MIMAT0004678
Previous IDshsa-miR-99b*
Sequence

45 - 

caagcucgugucuguggguccg

 - 66

Get sequence
Deep sequencing959 reads, 42 experiments
Evidence experimental; cloned [5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).