Stem-loop sequence hsa-mir-99b

Accession

MI0000746

Symbol

HGNC:MIR99B

Description

Homo sapiens miR-99b stem-loop

Gene family

MIPF0000025; mir-99

Stem-loop

     cc         ac   c    c - -   c 
ggcac  acccguaga  cga cuug g g ggc u
|||||  |||||||||  ||| |||| | | |||  
cugug  ugggugucu  gcu gaac c c ccg u
     cc         gu   c    a a g   c 

Deep sequencing

36267 reads, 39 experiments

Comments

This sequence is the predicted human homologue of mouse miR-99b, cloned from mouse brain [1] and embryonic stem cells [2,3]. Its expression was later validated in human [4-6].

Genome context

• Coordinates (GRCh37.p5): chr19: 52195865-52195934 [+]
• Overlapping transcripts:

  antisense

  ENST00000503177 ; AC018755.2-201; intron 1

Clustered miRNAs

< 10kb from hsa-mir-99b

• hsa-mir-99b: chr19: 52195865-52195934 [+]
• hsa-let-7e: chr19: 52196039-52196117 [+]
• hsa-mir-125a: chr19: 52196507-52196592 [+]

Database links

• ENTREZGENE: 407056;MIR99B
• HGNC: 31651;MIR99B

Mature sequence hsa-miR-99b-5p

• Accession: MIMAT0000689
• Previous IDs: hsa-miR-99b
• Sequence: 7 - cacccguagaaccgaccuugcg - 28
• Deep sequencing: 34426 reads, 31 experiments
• Evidence: experimental; cloned [4-6]
• Validated targets:
  • TARBASE:hsa-miR-99b-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-99b-5p
  • MICRORNA.ORG:hsa-miR-99b-5p
  • MIRDB:hsa-miR-99b-5p
  • RNA22-HSA:hsa-miR-99b-5p
  • TARGETMINER:hsa-miR-99b-5p
  • TARGETSCAN-VERT:hsa-miR-99b
  • PICTAR-VERT:hsa-miR-99b

Mature sequence hsa-miR-99b-3p

• Accession: MIMAT0004678
• Previous IDs: hsa-miR-99b*
• Sequence: 45 - caagcucgugucuguggguccg - 66
• Deep sequencing: 1841 reads, 23 experiments
• Evidence: experimental; cloned [5]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-99b-3p
  • MICRORNA.ORG:hsa-miR-99b-3p
  • MIRDB:hsa-miR-99b-3p
  • RNA22-HSA:hsa-miR-99b-3p
  • TARGETMINER:hsa-miR-99b-3p
  • PICTAR-VERT:hsa-miR-99b

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).