Stem-loop sequence hsa-mir-301a

AccessionMI0000745
Previous IDshsa-mir-301
Symbol HGNC:MIR301A
DescriptionHomo sapiens miR-301a stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   g     aa  c     a    uuau          cgauc       
Get sequence
Deep sequencing
2720 reads, 582 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells [1,3]. Its expression has also been confirmed in human ES cells [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 59151136-59151221 [-]
antisense
OTTHUMT00000449592 ; BCAS3-028; intron 4
OTTHUMT00000449593 ; BCAS3-029; intron 4
OTTHUMT00000449586 ; BCAS3-006; intron 11
OTTHUMT00000449585 ; BCAS3-005; intron 12
OTTHUMT00000449582 ; BCAS3-013; intron 18
OTTHUMT00000449571 ; BCAS3-004; intron 19
OTTHUMT00000449575 ; BCAS3-002; intron 19
OTTHUMT00000449581 ; BCAS3-012; intron 19
OTTHUMT00000449578 ; BCAS3-001; intron 20
ENST00000585979 ; BCAS3-028; intron 4
ENST00000592827 ; BCAS3-029; intron 4
ENST00000588874 ; BCAS3-006; intron 11
ENST00000585744 ; BCAS3-005; intron 12
ENST00000408905 ; BCAS3-013; intron 18
ENST00000589222 ; BCAS3-004; intron 19
ENST00000407086 ; BCAS3-002; intron 19
ENST00000588462 ; BCAS3-012; intron 19
ENST00000390652 ; BCAS3-001; intron 20
Database links

Mature sequence hsa-miR-301a-5p

Accession MIMAT0022696
Sequence

14 - 

gcucugacuuuauugcacuacu

 - 35

Get sequence
Deep sequencing1123 reads, 28 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-301a-3p

Accession MIMAT0000688
Previous IDshsa-miR-301;hsa-miR-301a
Sequence

51 - 

cagugcaauaguauugucaaagc

 - 73

Get sequence
Deep sequencing796 reads, 59 experiments
Evidence experimental; cloned [2,4], Northern [2]
Validated targets
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).