Stem-loop sequence hsa-mir-301a

AccessionMI0000745 (change log)
Previous IDshsa-mir-301
Symbol HGNC:MIR301A
DescriptionHomo sapiens miR-301a stem-loop
Gene family MIPF0000034; mir-130
Literature search

106 open access papers mention hsa-mir-301a
(559 sentences)

Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   g     aa  c     a    uuau          cgauc       
Get sequence
Deep sequencing
83786 reads, 228 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells [1,3]. Its expression has also been confirmed in human ES cells [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 59151136-59151221 [-]
antisense
OTTHUMT00000449592 ; BCAS3-028; intron 4
OTTHUMT00000449593 ; BCAS3-029; intron 4
OTTHUMT00000449586 ; BCAS3-006; intron 11
OTTHUMT00000449585 ; BCAS3-005; intron 12
OTTHUMT00000449582 ; BCAS3-013; intron 18
OTTHUMT00000449571 ; BCAS3-004; intron 19
OTTHUMT00000449575 ; BCAS3-002; intron 19
OTTHUMT00000449581 ; BCAS3-012; intron 19
OTTHUMT00000449578 ; BCAS3-001; intron 20
ENST00000585979 ; BCAS3-028; intron 4
ENST00000592827 ; BCAS3-029; intron 4
ENST00000588874 ; BCAS3-006; intron 11
ENST00000585744 ; BCAS3-005; intron 12
ENST00000408905 ; BCAS3-013; intron 18
ENST00000589222 ; BCAS3-004; intron 19
ENST00000407086 ; BCAS3-002; intron 19
ENST00000588462 ; BCAS3-012; intron 19
ENST00000390652 ; BCAS3-001; intron 20
Database links

Mature sequence hsa-miR-301a-5p

Accession MIMAT0022696
Sequence

14 - 

gcucugacuuuauugcacuacu

 - 35

Get sequence
Deep sequencing2578 reads, 125 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-301a-3p

Accession MIMAT0000688
Previous IDshsa-miR-301;hsa-miR-301a
Sequence

51 - 

cagugcaauaguauugucaaagc

 - 73

Get sequence
Deep sequencing81204 reads, 151 experiments
Evidence experimental; cloned [2,4], Northern [2]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).