Stem-loop sequence hsa-mir-301a

Accession

MI0000745

Previous IDs

hsa-mir-301

Symbol

HGNC:MIR301A

Description

Homo sapiens miR-301a stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

a     aa  a     c    ---u          ----a       
 cugcu  cg augcu ugac    uuauugcacu     cuguac 
 |||||  || ||||| ||||    ||||||||||     ||||| u
 gacga  gu uacga acug    gauaacguga     gacauu 
g     aa  c     a    uuau          cgauc       

Deep sequencing

1339 reads, 28 experiments

Comments

This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells [1,3]. Its expression has also been confirmed in human ES cells [2].

Genome context

• Coordinates (GRCh37.p5): chr17: 57228497-57228582 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000445939 ; SKA2-001; intron 1

  OTTHUMT00000445940 ; SKA2-003; intron 1

  OTTHUMT00000445941 ; SKA2-009; intron 1

  OTTHUMT00000445942 ; SKA2-005; intron 1

  OTTHUMT00000445943 ; SKA2-007; intron 1

  OTTHUMT00000445944 ; SKA2-008; intron 1

  OTTHUMT00000445945 ; SKA2-002; intron 1

  OTTHUMT00000445946 ; SKA2-006; intron 1

  OTTHUMT00000445947 ; SKA2-004; intron 1

  OTTHUMT00000445948 ; SKA2-010; intron 1

  ENST00000330137 ; SKA2-201; intron 1

  ENST00000437036 ; SKA2-202; intron 1

  ENST00000330137 ; SKA2-201; intron 1

  ENST00000437036 ; SKA2-202; intron 1

  ENST00000330137 ; SKA2-001; intron 1

  ENST00000580541 ; SKA2-003; intron 1

  ENST00000578105 ; SKA2-009; intron 1

  ENST00000578519 ; SKA2-005; intron 1

  ENST00000583927 ; SKA2-007; intron 1

  ENST00000581068 ; SKA2-008; intron 1

  ENST00000437036 ; SKA2-002; intron 1

  ENST00000583380 ; SKA2-006; intron 1

  ENST00000583976 ; SKA2-004; intron 1

  ENST00000584089 ; SKA2-010; intron 1

Database links

• ENTREZGENE: 407027;MIR301A
• HGNC: 31622;MIR301A

Mature sequence hsa-miR-301a-5p

• Accession: MIMAT0022696
• Sequence: 14 - gcucugacuuuauugcacuacu - 35
• Deep sequencing: 988 reads, 20 experiments
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-301a-5p
  • MIRDB:hsa-miR-301a-5p
  • TARGETMINER:hsa-miR-301a-5p
  • PICTAR-VERT:hsa-miR-301

Mature sequence hsa-miR-301a-3p

• Accession: MIMAT0000688
• Previous IDs: hsa-miR-301;hsa-miR-301a
• Sequence: 51 - cagugcaauaguauugucaaagc - 73
• Deep sequencing: 351 reads, 19 experiments
• Evidence: experimental; cloned [2,4], Northern [2]
• Validated targets:
  • TARBASE:hsa-miR-301a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-301a-3p
  • MICRORNA.ORG:hsa-miR-301a-3p
  • MIRDB:hsa-miR-301a-3p
  • RNA22-HSA:hsa-miR-301a-3p
  • TARGETMINER:hsa-miR-301a-3p
  • TARGETSCAN-VERT:hsa-miR-301a
  • PICTAR-VERT:hsa-miR-301

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).