Stem-loop sequence hsa-mir-299

AccessionMI0000744 (change log)
Symbol HGNC:MIR299
DescriptionHomo sapiens miR-299 stem-loop
Gene family MIPF0000186; mir-299
Stem-loop
        a                      uu 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  g
3' uucuu gccaaaugguaggguguaugua  a
        c                      ua 
Get sequence
Deep sequencing
1180 reads, 41 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The sequence from the 5' arm of this miRNA precursor is the predicted human homologue of mouse miR-299, cloned from mouse embryonic stem cells [1,2], later validated in human [4]. Altuvia et al [3] report the cloning of a miRNA sequence from the 3' arm of the same precursor in human.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101023794-101023856 [+]
antisense
OTTHUMT00000414334 ; BEGAIN-007; intron 1
OTTHUMT00000414329 ; BEGAIN-001; intron 2
OTTHUMT00000414331 ; BEGAIN-005; intron 2
OTTHUMT00000414332 ; BEGAIN-003; intron 2
OTTHUMT00000414335 ; BEGAIN-006; intron 2
OTTHUMT00000414337 ; BEGAIN-004; intron 2
ENST00000557378 ; BEGAIN-007; intron 1
ENST00000443071 ; BEGAIN-201; intron 1
ENST00000355173 ; BEGAIN-001; intron 2
ENST00000553553 ; BEGAIN-005; intron 2
ENST00000556188 ; BEGAIN-003; intron 2
ENST00000554140 ; BEGAIN-006; intron 2
ENST00000554747 ; BEGAIN-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-299
hsa-mir-379chr14: 101022066-101022132 [+]
hsa-mir-411chr14: 101023325-101023420 [+]
hsa-mir-299chr14: 101023794-101023856 [+]
hsa-mir-380chr14: 101025017-101025077 [+]
hsa-mir-1197chr14: 101025564-101025651 [+]
hsa-mir-323achr14: 101025732-101025817 [+]
hsa-mir-758chr14: 101026020-101026107 [+]
hsa-mir-329-1chr14: 101026785-101026864 [+]
hsa-mir-329-2chr14: 101027100-101027183 [+]
hsa-mir-494chr14: 101029634-101029714 [+]
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
Database links

Mature sequence hsa-miR-299-5p

Accession MIMAT0002890
Sequence

7 - 

ugguuuaccgucccacauacau

 - 28

Get sequence
Deep sequencing681 reads, 35 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

Mature sequence hsa-miR-299-3p

Accession MIMAT0000687
Previous IDshsa-miR-299;hsa-miR-299-5p
Sequence

39 - 

uaugugggaugguaaaccgcuu

 - 60

Get sequence
Deep sequencing499 reads, 35 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
3
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).