Stem-loop sequence hsa-mir-34c

Accession MI0000743
Symbol HGNC:MIR34C
Description Homo sapiens miR-34c stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ag     a   a    a     c      c  a 
agucu  uuacu ggc gugu guuag ugauug ua u
|||||  ||||| ||| |||| ||||| |||||| ||  
uuaga  aaugg ccg caca caauc acuaac au a
     aa     a   g    c     -      c  g 
Get sequence
Deep sequencing
8857 reads, 22 experiments
Comments

Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MI0000403 ), miR-34b (MI0000404 ) and miR-34a (MI0000584 ) to clarify homology with human sequences.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 111384164-111384240 [+]
sense
ENST00000540312 ; AP002008.1-201; exon 2
Clustered miRNAs
< 10kb from hsa-mir-34c
hsa-mir-34b chr11: 111383663-111383746 [+]
hsa-mir-34c chr11: 111384164-111384240 [+]
Database links

Mature sequence hsa-miR-34c-5p

Accession MIMAT0000686
Previous IDs hsa-miR-34c
Sequence

13 - 

aggcaguguaguuagcugauugc

 - 35

Get sequence
Deep sequencing 8819 reads, 15 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-34c-3p

Accession MIMAT0004677
Sequence

46 - 

aaucacuaaccacacggccagg

 - 67

Get sequence
Deep sequencing 38 reads, 10 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).