Stem-loop sequence hsa-mir-34c

AccessionMI0000743 (change log)
Symbol HGNC:MIR34C
DescriptionHomo sapiens miR-34c stem-loop
Gene family MIPF0000039; mir-34
Literature search

448 open access papers mention hsa-mir-34c
(2506 sentences)

Stem-loop
        ag     a   a    a     c      c  a 
5' agucu  uuacu ggc gugu guuag ugauug ua u
   |||||  ||||| ||| |||| ||||| |||||| ||  
3' uuaga  aaugg ccg caca caauc acuaac au a
        aa     a   g    c     -      c  g 
Get sequence
Deep sequencing
207792 reads, 380 reads per million, 137 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MI0000403), miR-34b (MI0000404) and miR-34a (MI0000584) to clarify homology with human sequences.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 111513439-111513515 [+]
sense
OTTHUMT00000319352 ; SIK2-001; intron 3
ENST00000304987 ; SIK2-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-34c
hsa-mir-34bchr11: 111512938-111513021 [+]
hsa-mir-34cchr11: 111513439-111513515 [+]
Database links

Mature sequence hsa-miR-34c-5p

Accession MIMAT0000686
Previous IDshsa-miR-34c
Sequence

13 - 

aggcaguguaguuagcugauugc

 - 35

Get sequence
Deep sequencing204545 reads, 131 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-34c-3p

Accession MIMAT0004677
Sequence

46 - 

aaucacuaaccacacggccagg

 - 67

Get sequence
Deep sequencing3247 reads, 122 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).